http://ipt.biodiversity.aq/resource?r=bacteria_antarctic_terrestrial_soils Bacteria (16S) in Antarctic terrestrial soils of the Sor Rondane Mountains Bjorn Tytgat Ghent University Post doctoral assistent
Krijgslaan 281 Ghent 9000 BE
bjorn.tytgat@ugent.be
Wim Vyverman Ghent University Professor
Krijgslaan 281 Ghent 9000 BE
wim.vyverman@ugent.be
Anne Willems Ghent University Professor
Ghent 9000 BE
anne.willems@ugent.be
Elie Verleyen Ghent University Professor
Krijgslaan 281 Ghent 9000 BE
Elie.verleyen@ugent.be
Maxime Sweetlove Royal Belgian Institute for Natural Sciences assistent researcher
Rue Vautier 29 Brussels 1000 BE
msweetlove@naturalsciences.be
Bjorn Tytgat Ghent University Post doctoral assistent
Krijgslaan 281 Ghent 9000 BE
bjorn.tytgat@ugent.be contentProvider
Elie Verleyen Ghent University Professor
Krijgslaan 281 Ghent 9000 BE
elie.verleyen@ugent.be contentProvider
Wim Vyverman Ghent University Professor
Krijgslaan 281 Ghent 9000 BE
wim.vyverman@ugent.be contentProvider
Anne Willems Ghent University Professor
BE
anne.willems@ugent.be principalInvestigator
Karolien Peeters Ghent University Post doctoral researcher
BE
contentProvider
Zorigto Namsaraev Kurchatov Institute Post doctoral researcher 2018-11-19 eng Illumina sequencing data of bacterial communities in 52 soil samples from the western Sør Rondane Mountains (Dronning Maud Land, East Antarctica).The samples were taken along broad environmental gradients, including different types of bedrock, in an area covering nearly 1000 km2. Metadata GBIF Dataset Type Vocabulary: http://rs.gbif.org/vocabulary/gbif/dataset_type.xml This work is licensed under a Creative Commons Attribution (CC-BY) 4.0 License. Sor Ronda Mountains, East Antarctica 22.7 24.6 -71.8 -72.1 2009 2010 16S ssh rRNA gene of Bacteria, using the primers pA (AGAGTTTGATCCTGGCTCAG, positions 8–27) and BKL1 (GTATTACCGCGGCTGCTGGCA, positions 536–516) domain Bacteria bacteria unkown Bjorn Tytgat Ghent University Post doctoral assistent
Krijgslaan 281 Ghent 9000 BE
bjorn.tytgat@ugent.be
BELDIVA-AMBIO Bjorn Tytgat This research was funded by the Special Research Fund BOF of (grant ) and by the Belgian Science Policy Office (BelSPO) projects BELDIVA (EA/00/05), AMBIO (SD/BA/01A) and CCAMBIO (SD/BA/03A). A. Wilmotte is Research Associate of the FRS-FNRS. This study is a contribution to the State of the Antarctic Ecosystem (AntEco) research program of the Scientific Committee on Antarctic Research (SCAR). The Sop Ronda Mountains (SRM) (22° E-28° E, 71°30′ S-72°40′ S) are a 220 km long, east-west oriented mountain range, situated about 200 km inland, with peaks reaching 3300 m a.s.l. The bedrock is mainly metamorphic (e.g. gneiss) with some plutonic (granite) outcrops.
2018-11-14T03:00:46.659+01:00 dataset Tytgat B, Vyverman W, Willems A, Verleyen E (2018): Bacteria (16S) in Antarctic terrestrial soils of the Sor Rondane Mountains. v1.3. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. http://ipt.biodiversity.aq/resource?r=bacteria_antarctic_terrestrial_soils&v=1.3 Tytgat, B., Verleyen, E., Sweetlove, M., D'hondt, S., Clercx, P., Van Ranst, E., ... & Vyverman, W. (2016). Bacterial community composition in relation to bedrock type and macrobiota in soils from the Sør Rondane Mountains, East Antarctica. FEMS microbiology ecology, 92(9). http://ipt.biodiversity.aq/resource?id=bacteria_antarctic_terrestrial_soils/v1.3.xml