Associated microbiome (Bacteria and Fungi) in Antarctic sea stars (healthy versus exhibiting epidermal disease)

Versions

The table below shows only published versions of the resource that are publicly accessible.

How to cite

Please be aware, this is an old version of the dataset.  Researchers should cite this work as follows:

Núñez-Pons L, Work T, Angulo-Preckler C, Moles J, Avila C (2018): Associated microbiome (Bacteria and Fungi) in Antarctic sea stars (healthy versus exhibiting epidermal disease). v1.0. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. http://ipt.biodiversity.aq/resource?r=associated_microbiome_antarctic_sea_stars&v=1.0

Rights

Researchers should respect the following rights statement:

The publisher and rights holder of this work is SCAR - Microbial Antarctic Resource System. This work is licensed under a Creative Commons Attribution (CC-BY 4.0) License.

GBIF Registration

This resource has been registered with GBIF, and assigned the following GBIF UUID: 5400a04a-01ba-46d3-8470-d256219e6a6a.  SCAR - Microbial Antarctic Resource System publishes this resource, and is itself registered in GBIF as a data publisher endorsed by Scientific Committee on Antarctic Research.

Keywords

Metadata

Contacts

Geographic Coverage

Deception island, Antarctica

Taxonomic Coverage

microbiome (bacteria (16S ssu rRNA gene) and Fungi (ITS)) associated with Antarctic sea stars (Odontaster validus)

Temporal Coverage

Project Data

No Description available

The personnel involved in the project:

Sampling Methods

Twenty-five healthy and diseased O validus (n = 50) were collected by SCUBA diving on February 2013. Tissue biopsies (1 cm3) were removed with sterile scalpel from 30 individuals (15 healthy and 15 diseased) as follows: 15 sections from healthy specimens, 15 affected lesion fronts from diseased sea stars, and 15 tissue areas several cm away from the lesions of the same diseased specimens. Samples were divided in two subsamples, one preserved in 100% ethanol at −20 °C for DNA extraction and microbial characterization, and the other fixed in 2.5% paraformaldehyde in filtered sea water at 4 °C for histopathology studies.

Method step description:

1. DNA from healthy and lesioned tissues of healthy and diseased stars were extracted using a modified C-TAB organic extraction protocol for amplicon deep sequencing of ribosomal gene target markers on MiSeq (Illumina), for bacterial/archaeal and fungal community composition, which were performed with a two-PCR protocol and two dual-index strategy. In the first PCR, we used bacterial specific primers to amplify the V3–V4 region of the small-subunit ribosomal RNA (16S) gene (341 F and 785 R); and fungi-specific primers ITS1F41 and ITS2R targeting the internal transcribed spacer 1 (ITS1) region of fungi. Amplifications were performed in 25 µl reactions with NEBNext® Q5® Hot Start HiFi PCR Master Mix (New England Biolabs, Inc.), 0.8 µl BSA (Bovine Serum Albumin; 20 mg/ml), 1 µl of each 5 µM primer, and 1.5 µl of template. Reactions were under the thermocycling profile: 98 °C for 2 min, then 28 cycles of 98 °C for 15 s, 53 °C for 30 s, 72 °C for 30 s, final extension at 72 °C for 2 min. The second Index PCR to attach dual indexes and Illumina sequencing adapters used forward primers with the 5′-3′ Illumina i5 adapter (AATGATACGGCGACCACCGAGATCTACAC), an 8–10 bp barcode and a primer pad; and reverse fusion primers with 5′-3′ Illumina i7 adapter (CAAGCAGAAGACGGCATACGAGAT), an 8–10 bp barcode, a primer pad. Reactions were made in 25 μl with 0.5 µl of each 5 µM primer, and 1 µl of corresponding products from first amplicon PCR reactions diluted (1:30), and with a temperature regime of: 98 °C for 2 min, then 28 cycles of 98 °C for 15 s, 55 °C for 30 s, 72 °C for 30 s, final extension at 72 °C for 2 min. The PCR products were purified and pooled equimolar on Just-a-Plate™ 96 PCR Purification and Normalization Kit plates following manufacturer’s instructions (Charm Biotec).
2. Paired-end sequencing was performed on an Illumina MiSeq sequencer 2 × 300 flow cell at 10 pM at Core Lab, Hawai’i Institute of Marine Biology (Hawai’i, USA).

Bibliographic Citations

1. Núñez-Pons, L., Work, T. M., Angulo-Preckler, C., Moles, J., & Avila, C. (2018). Exploring the pathology of an epidermal disease affecting a circum-Antarctic sea star. Scientific reports, 8(1), 11353.

Additional Metadata