Integrated Publishing Toolkit(IPT)

free and open access to biodiversity data

Bacteria in Antarctic glacial foreland soils

Latest version published by SCAR - Microbial Antarctic Resource System on Dec 17, 2018 SCAR - Microbial Antarctic Resource System

Amplicon sequencing dataset (Illumina MiSeq) of Bacteria (16S ssu rRNA) in an Antarctic glacial foreland soil gradient

Downloads

Download the latest version of the metadata-only resource metadata as EML or RTF:

Metadata as an EML file download in English (9 KB)
Metadata as an RTF file download in English (11 KB)

Versions

The table below shows only published versions of the resource that are publicly accessible.

How to cite

Researchers should cite this work as follows:

Yan W, Ma H, Shi G, Sun B, Xiao X, Zhang Y (2018): Bacteria in Antarctic glacial foreland soils. v1.1. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. http://ipt.biodiversity.aq/resource?r=bacteria_antarctic_glacial_foreland_soils&v=1.1

Rights

Researchers should respect the following rights statement:

The publisher and rights holder of this work is SCAR - Microbial Antarctic Resource System. This work is licensed under a Creative Commons Attribution (CC-BY) 4.0 License.

GBIF Registration

This resource has been registered with GBIF, and assigned the following GBIF UUID: 8e7cf0b8-4789-4b79-9dc9-33d65ed79918.  SCAR - Microbial Antarctic Resource System publishes this resource, and is itself registered in GBIF as a data publisher endorsed by Scientific Committee on Antarctic Research.

Keywords

Metadata

Contacts

Who created the resource:

Wenkai Yan
Researcher
Shanghai Jiao Tong University Shanghai CN
Hongmei Ma
Researcher
Polar Research Institute of China Shanghai CN
Guitao Shi
Researcher
Polar Research Institute of China Shanghai CN
Bo Sun
Researcher
Polar Research Institute of China Shanghai CN
Xiang Xiao
Researcher
Shanghai Jiao Tong University Shanghai CN
Yu Zhang
Researcher
Shanghai Jiao Tong University Shanghai CN

Who can answer questions about the resource:

Wenkai Yan
Researcher
Shanghai Jiao Tong University Shanghai CN

Who filled in the metadata:

Maxime Sweetlove
Research assistent
Royal Belgian Institute for Natural Sciences Rue Vautier 29 1000 Brussels BE

Who else was associated with the resource:

User

Geographic Coverage

Soil samples were collected from the glacial foreland in Larsemann Hills in East Antarctica

Bounding Coordinates South West [-69, 76.407], North East [-69, 76.407]

Taxonomic Coverage

Bacteria 16S ssu rRNA marker gene, v4 region

Domain  Bacteria (Bacteria)

Project Data

No Description available

Title Bacteria in Antarctic glacial foreland soils
Funding Funding was provided by the National Natural Science Foundation of China (grants 41276202, 41476123, 41676177), China Ocean Mineral Resources R&D Association (grants DY125-22-04), and the thirteen Five-Year Plan for Polar Science (grants CHINARE 2016-02-02).

The personnel involved in the project:

Wenkai Yan

Sampling Methods

Surface soil layers, approximately 5 cm, were collected. When sites were covered by ice (3,4 and 5), the covering ice was gently cracked and the ice fractures were removed before sampling the soil beneath. The samples were stored in plastic bags and kept at -20°C during transport and storage in the laboratory until they were used for further analysis.

Study Extent Soil samples were collected from the glacial foreland in Larsemann Hills in East Antarctica (-69.39762S, 76.40666 E), during the 29th Chinese National Antarctic Research Expedition in the Antarctic summer in February 2013.

Method step description:

  1. Each soil sample was homogenized and sub-sampled for DNA extraction and geochemical measurements.
  2. An SDS-based method was employed to extract the DNA from soil (Natarajan et al., 2016). The bacterial V4 region of the 16S rRNA gene was amplified with a special bacterial primer pair 533F (TGCCAGCAGCCGCGGTAA)/Bact806R (GGACTACCAGGGTATCTAATCCTGTT). A sample tagging approach was employed, and a different barcode was added before the forward primer for each sample. The PCR reagents were mixed as follow: 5 μl of 10× Taq buffer (Takara, Otsu, Shiga, Japan), 4 μl of dNTP (Takara, Otsu, Shiga, Japan), 1 μl of each primer (10 μM stored concentration), 0.25 μl of Ex Taq DNA polymerase (Takara, Otsu, Shiga, Japan), approximately 50 ng of DNA, 2.5 μl of BSA (Bull Serum Albumin), and 32.75 μl of water. The PCR amplification consisted of an initial denaturation at 94°C for 5 min; 25 cycles of denaturation at 94°C for 40 s, annealing at 58°C for 40 s, and extension at 72°C for 1 min; and a final extension at 72°C for 8 min. The PCR products were purified with a Gel Extraction Kit (Omega Bio-Tek, Norcross, GA, United States) according to the manufacturer’s instructions.
  3. The reads were obtained with MiSeq sequencing platform (Illumina, San Diego, CA, United States).

Bibliographic Citations

  1. Yan, W., Ma, H., Shi, G., Li, Y., Sun, B., Xiao, X., & Zhang, Y. (2017). Independent Shifts of Abundant and Rare Bacterial Populations across East Antarctica Glacial Foreland. Frontiers in microbiology, 8, 1534.