Integrated Publishing Toolkit(IPT)

free and open access to biodiversity data

Bacterial Diversity Assessment in Antarctic Terrestrial and Aquatic Microbial Mats

Latest version published by SCAR - Microbial Antarctic Resource System on Nov 27, 2018 SCAR - Microbial Antarctic Resource System

Bacterial data (16S rRNA) from terrestrial and aquatic Microbial mats in continental Antarctic.

Downloads

Download the latest version of the metadata-only resource metadata as EML or RTF:

Metadata as an EML file download in English (15 KB)
Metadata as an RTF file download in English (13 KB)

Versions

The table below shows only published versions of the resource that are publicly accessible.

How to cite

Researchers should cite this work as follows:

Tytgat B, Vrleyen E, Obbels D, Peeters K, De Wever A, D'hondt S, De Meyer T, van Criekinge W, Vyverman W, Willems A (2018): Bacterial Diversity Assessment in Antarctic Terrestrial and Aquatic Microbial Mats. v1.0. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. http://ipt.biodiversity.aq/resource?r=bacterial_diversity_antarctica_microbial_mats&v=1.0

Rights

Researchers should respect the following rights statement:

The publisher and rights holder of this work is SCAR - Microbial Antarctic Resource System. This work is licensed under a Creative Commons Attribution (CC-BY) 4.0 License.

GBIF Registration

This resource has been registered with GBIF, and assigned the following GBIF UUID: f3a8b1d6-a1d1-4292-8a7e-19c63a0825bd.  SCAR - Microbial Antarctic Resource System publishes this resource, and is itself registered in GBIF as a data publisher endorsed by Scientific Committee on Antarctic Research.

Keywords

lake; soil; bacteria; antarctica; 16S

Contacts

Who created the resource:

Bjorn Tytgat
Post doctoral assistent
Ghent University Krijgslaan 281 9000 Gent BE
Elie Vrleyen
Professor
Ghent University Krijgslaan 281 9000 Gent BE
Dagmar Obbels
PhD student
Ghent University Krijgslaan 281 9000 Gent BE
Karolien Peeters
Post doctoral researcher
Ghent University Krijgslaan 281 9000 Gent BE
Aake De Wever
Post doctoral assistent
Royal Belgian Institute for Natural Sciences Krijgslaan 281 1000 Brussels BE
Sofie D'hondt
Lab technician
Ghent University
Tim De Meyer
Professor
Ghent University
Wim van Criekinge
Post doctoral researcher
GhentUniversity
Wim Vyverman
Professor
Ghent University
Anne Willems
Professor
Ghent Univeristy

Who can answer questions about the resource:

Bjorn Tytgat
Post doctoral assistent
Ghent University Krijgslaan 281 9000 Gent BE

Who filled in the metadata:

Maxime Sweetlove
Royal Belgian Institute for Natural Sciences Rue Vautier 29 1000 Brussels BE

Who else was associated with the resource:

Content Provider
Bjorn Tytgat
Post doctoral assistent
Ghent University Krijgslaan 281 9000 Gent BE
Content Provider
Karolien Peeters
Post doctoral researcher
Ghent University 9000 Gent BE
Content Provider
Anne Willems
Professor
Ghent University 9000 Gent BE

Geographic Coverage

soil samples and lake samples from East Antarctica

Bounding Coordinates South West [-80.45, -67.45], North East [-67.7, 39.8]

Taxonomic Coverage

Bacterial 16S amplicons (V1-V3 region)

Domain  Bacteria (Bacteria)

Temporal Coverage

Start Date / End Date 2003-01-01 / 2007-01-01

Project Data

CCAMBIO (Climate Change and Antarctic Microbial Biodiversity) is an academic project funded by the Belgian Federal Science Policy (BELSPO). Its main objective is to study the diversity, biogeographic zoning and genomic make-up of lacustrine microbial mat communities in the Antarctic Realm. CCAMBIO is composed by researchers from four Belgian Universities and Institutes (University of Liège, Ghent University, National Botanical Garden of Belgium and Royal Belgian Institute of Natural Sciences), as well as collaborators from the British Antarctic Survey.

Title CCAMBIO
Identifier CCAMBIO
Funding Belgian Science Policy Office (BelSPO) project SD/BA/03

The personnel involved in the project:

Bjorn Tytgat
Elie Verleyen
Dagmar Obbels
Anne Willems
Wim Vyverman

Sampling Methods

Two terrestrial and seven limnetic microbial mat samples were collected aseptically during different field campaigns in December/January 2003 (PQ1, TM2 and TM4) and in January 2007 (BB50, BB115, LA3, SK5, WO10 and SO6). All samples were kept frozen during transport and stored at 220uC.

Study Extent One sample (PQ1) was collected on Pourquoi-Pas Island off the west coast of Graham Land (Antarctic Peninsula). All other samples were collected from Eastern Antarctic habitats. The two terrestrial microbial mat samples (BB50 and BB115) were taken near the Utsteinen nunatak in the Sør Rondane Mountains (Dronning Maud Land). Three samples were from Lu ̈tzow-Holm Bay (Dronning Maud Land), namely from a small saline lake in Langhovde (LA3), from Naka-Tempyo Lake (SK5) in Skarvsnes, and from a small saline pond (WO10) in West Ongul Island. One sample (SO6) was taken from Lake Melkoye (unofficial name) in Schirmacher Oasis (Dronning Maud Land). The two remaining samples were collected in the Transantarctic Mountains. Sample TM2 was taken from Forlidas Pond (Dufek Massif, Pensacola Mountains), while sample TM4 was taken from Lundstro ̈m Lake (Shackleton Range).

Method step description:

  1. DNA was extracted from frozen samples using 5 g per sample. Extracellular DNA was first removed as described by Corinaldesi et al. and DNA extraction was subsequently performed according to Zwart et al. Sequencing of the 16S rRNA V1–V3 regions was performed using forward primer pA (AGAGTTTGATCCTGGCTCAG 8–27) and reverse primer BKL1 (GTATTACCGCGGCTGCTGGCA 536– 516). Because it proved impossible to concatenate the comple- mentary reads due to insufficient overlap, the forward and reverse sequences were analyzed separately. The forward reads hence cover the complete V1 and V2 regions, whereas the reverse reads cover the V3 and part of the V2 region for the longest sequences.
  2. Multiplexing was done with barcodes proposed by Parames- waran et al. Each PCR mixture contained 1–2 ml of template DNA, 2 ml of fusion primers and barcodes (10 mM), 2.5 ml dNTPs (10 mM), 1.5 ml of 10x buffer, 0.25 ml of 5 U/ml FastStart High Fidelity Polymerase (Roche) and was adjusted to a final volume of 25 ml with sterile HPLC-water. PCR cycling included 3 min at 94uC, followed by 35 cycles of 94uC for 30 s, 55uC for 60 s and 72uC for 90 s and finally 8 min at 72uC. PCR products were purified using a High Pure PCR Product Purification Kit (Roche).
  3. Pyrosequencing was performed on a Roche 454 GS FLX Titanium machine at NXTGNT (Ghent, Belgium) after quality control of the DNA with a Qubit 2.0 Fluorometer (Life Technologies) and a Bioanalyzer (Agilent Technologies).

Bibliographic Citations

  1. Tytgat, B., Verleyen, E., Obbels, D., Peeters, K., De Wever, A., D’hondt, S., ... & Willems, A. (2014). Bacterial diversity assessment in Antarctic terrestrial and aquatic microbial mats: a comparison between bidirectional pyrosequencing and cultivation. PloS one, 9(6), e97564.