Antarctic cryptoendolithic fungal communities ITS amplicon sequencing

Última versión Publicado por SCAR - Microbial Antarctic Resource System en Mar 19, 2019 SCAR - Microbial Antarctic Resource System

Amplicon sequencing dataset of cryptoendolithic (sandstone) fungal communities (ITS1 marker gene) in Victoria Land (continental Antarctica).

Descargas

Descargue la última versión de los metadatos como EML o RTF:

Metadatos como un archivo EML descargar en Inglés (10 KB)
Metadatos como un archivo RTF descargar en Inglés (11 KB)

Versiones

La siguiente tabla muestra sólo las versiones publicadas del recurso que son de acceso público.

¿Cómo referenciar?

Los usuarios deben citar este trabajo de la siguiente manera:

Coleine C, Zucconi L, Onofri S, Pombubpa N, Stajich J, Selbman L (2018): Antarctic cryptoendolithic fungal communities ITS amplicon sequencing. v1.2. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=antarctic_cryptoendolithic_microbial_fungi_its&v=1.2

Derechos

Los usuarios deben respetar los siguientes derechos de uso:

El publicador y propietario de los derechos de este trabajo es SCAR - Microbial Antarctic Resource System. This work is licensed under a Creative Commons Attribution (CC-BY) 4.0 License.

Registro GBIF

Este recurso ha sido registrado en GBIF con el siguiente UUID: b94f714c-e890-4365-81a5-968a20606d37.  SCAR - Microbial Antarctic Resource System publica este recurso, y está registrado en GBIF como un publicador de datos avalado por Scientific Committee on Antarctic Research.

Palabras Clave

Metadata

Contactos

¿Quién creó el recurso?:

Claudia Coleine
University of Tuscia Viterbo IT
Laura Zucconi
University of Tuscia Viterbo IT
Silvano Onofri
University of Tuscia Viterbo IT
Nuttapon Pombubpa
University of California US
Jason Stajich
University of California US
Laura Selbman
University of Tuscia Viterbo IT

¿Quién puede resolver dudas acerca del recurso?:

Claudia Coleine
University of Tuscia Viterbo IT

¿Quién documentó los metadatos?:

Maxime Sweetlove
Research assistent
Royal Belgian Institute of Natural Sciences Rue Vautier 29 1000 Brussels

¿Quién más está asociado con el recurso?:

Usuario
Maxime Sweetlove

Cobertura Geográfica

Victoria Land (Continental Antarctica)

Coordenadas límite Latitud Mínima Longitud Mínima [-77.91, 159.233], Latitud Máxima Longitud Máxima [-74.169, 162.514]

Cobertura Taxonómica

microbial fungi (ITS1)

Filo  Fungi (Fungi)

Datos del Proyecto

No hay descripción disponible

Título Antarctic cryptoendolithic fungal communities
Fuentes de Financiación Sequencing was supported by funds through United States Department of Agriculture—National Institute of Food and Agriculture Hatch project CA-R-PPA-5062-H. Data analyses were performed on the High-Performance Computing Cluster at the University of California-Riverside in the Institute of Integrative Genome Biology supported by NSF DBI-1429826 and NIH S10-OD016290. Additional support was given through a Royal Thai government fellowship.

Personas asociadas al proyecto:

Claudia Coleine

Métodos de Muestreo

Rock samples were excised aseptically, transported, and stored at −20 °C at the Tuscia University (Viterbo, Italy) until processing.

Área de Estudio Sandstone rock samples were collected in triplicate in Victoria Land (Continental Antarctica), along a latitudinal transect from 74°10′10.5′′ S 162°25′38.0′′ E (Timber Peak, Northern Victoria Land) to 77°54′43.6′′ S 161°34′39.3′′ E (Finger Mt., Southern Victoria Land) ranging from 834 m a.s.l. (Battleship Promontory, Southern Victoria Land) to 3100 m a.s.l. (Mt. New Zealand, Northern Victoria Land). In addition, rocks with different sun exposures were collected from four visited sites (Battleship Promontory, Siegfried Peak, Finger Mt. and University Valley). All sites were visited during the XXXII Italian Antarctic Expedition (2015–2016).

Descripción de la metodología paso a paso:

  1. Rocks were crushed using a Grinder MM 400 RETSCH (Verder Scientific, Bologna, Italy) in sterile conditions to avoid contamination.
  2. Metagenomic DNA was extracted from 0.3 g of rocks using MOBIO Power Soil DNA Extraction kit (MOBIO Laboratories, Carlsbad, CA, USA), according to the manufacturer’s instructions. ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2 (GCTGCGTTCTTCATCGATGC) primers were used to amplify the internal transcribed spacer 1 region (ITS1). PCR reactions were performed in a total volume of 25 μL, containing 1 μL of each primer, 12.5 μL of Taq DNA Polymerase (Thermo Fischer Scientific Inc., Waltham, MA, USA), 9.5 μL of nuclease-free water (Sigma-Aldrich, St. Louis, MO, USA) and 5 ng of DNA, following Coleine et al. PCR conditions were initial denaturation at 93 °C for 3 min, 35 cycles of denaturation at 95 °C for 45 s, annealing at 50 °C for 1 min, extension at 72°C for 90 s, followed by a final extension at 72 °C for 10 min in an automated thermal cycler (BioRad, Hercules, CA, USA). Amplicons, purified with Qiagen PCR CleanUp kit (Macherey-Nagel, Hoerdt, France) and quantified using the Qubit dsDNA HS Assay Kit (Life Technologies, Carlsbad, CA, USA), were tagged with unique barcodes to enable identification of each sample, and then pooled for run sequencing.
  3. Sequencing (paired-end reads, 2 × 300 bp) of the pooled libraries was performed on a single Illumina MiSeq flowcell at the Institute for Integrative Genome Biology, University of California, Riverside.

Referencias Bibliográficas

  1. Coleine, C., Zucconi, L., Onofri, S., Pombubpa, N., Stajich, J., & Selbmann, L. (2018). Sun Exposure Shapes Functional Grouping of Fungi in Cryptoendolithic Antarctic Communities. Life, 8(2), 19.

Metadatos Adicionales

Identificadores Alternativos b94f714c-e890-4365-81a5-968a20606d37
https://ipt.biodiversity.aq/resource?r=antarctic_cryptoendolithic_microbial_fungi_its