Antarctic snow algae communities

Latest version published by SCAR - Microbial Antarctic Resource System on Mar 19, 2019 SCAR - Microbial Antarctic Resource System

Amplicon sequencing dataset of Eukaryotes (18S-ITS) and Bacteria (16S) in green and red snow algae blooms on Antarctic snow.

Downloads

Download the latest version of the metadata-only resource metadata as EML or RTF:

Metadata as an EML file download in English (12 KB)
Metadata as an RTF file download in English (13 KB)

Versions

The table below shows only published versions of the resource that are publicly accessible.

How to cite

Researchers should cite this work as follows:

Davey M, Norman L, Sterk P, Huete-Ortega M, BunBury F, Kin Wai Loh B, Peck L, Conevy P, Newsham K, Smith A (2019): Antarctic snow algae communities. v1.1. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=antarctic_snow_algae_communities&v=1.1

Rights

Researchers should respect the following rights statement:

The publisher and rights holder of this work is SCAR - Microbial Antarctic Resource System. This work is licensed under a Creative Commons Attribution (CC-BY) 4.0 License.

GBIF Registration

This resource has been registered with GBIF, and assigned the following GBIF UUID: 3e77139d-6fbc-4e4e-86f0-ca966d398874.  SCAR - Microbial Antarctic Resource System publishes this resource, and is itself registered in GBIF as a data publisher endorsed by Scientific Committee on Antarctic Research.

Keywords

Metadata

Contacts

Who created the resource:

Matthew Davey
University of Cambridge Cambridge GB
Louisa Norman
University of Cambridge Cambridge GB
Peter Sterk
University of Cambridge Cambridge GB
Maria Huete-Ortega
University of Cambridge Cambridge GB
Freddy BunBury
University of Cambridge Cambridge GB
Bradford Kin Wai Loh
University of Cambridge Cambridge GB
Lloyd Peck
British Antarctic Survey Cambridge GB
Peter Conevy
British Antarctic Survey Cambridge GB
Kevin Newsham
British Antarctic Survey Cambridge GB
Alison Smith
University of Cambridge Cambridge GB

Who can answer questions about the resource:

Matthew Davey
University of Cambridge Cambridge GB

Who filled in the metadata:

Maxime Sweetlove
Research assistent
Royal Belgian Institute of Natural Sciences Rue Vautier 29 1000 Brussels BE

Who else was associated with the resource:

User

Geographic Coverage

Rothera Point, Anchorage Island, Léonie Island and Lagoon Island: Ryder Bay: Antarctic Peninsula

Bounding Coordinates South West [-67.586, -68.133], North East [-67.586, -68.133]

Taxonomic Coverage

Bacteria (16S ssu rRNA marker gene)

Domain  Bacteria (Bacteria)

Eukaryotes (18S ssu rRNA- ITS marker)

Domain  Eukarya (Eukaryotes)

Temporal Coverage

Formation Period 2015-01/02

Project Data

No Description available

Title Antarctic snow algae communities
Funding The research expedition was funded by a NERC Collaborative Gearing Scheme award (RJCGS14MPD) in 2014/15. Additional support was given by the European Union (project no. 215G) INTERREG IVB ‘Energetic Algae’ (EnAlgae) program and a Leverhulme Trust Research Grant (RPG-2017-077). The metabarcoding analysis was supported by a Collaboration Voucher from the British Antarctic Survey and carried out by the Cambridge Genomic Services (University of Cambridge, Department of Pathology).

The personnel involved in the project:

Matthew Davey

Sampling Methods

Snow samples were (1-5cm depth) taken in 6 x 50 ml sterile plastic sample tubes. The algae were collected by filling a sterile 50 ml tube with snow, which was not compacted.

Study Extent Snow algae communities were collected from layers of green and red dominant snow algal blooms at four locations in Ryder Bay, Antarctic Peninsula (Rothera Point, Anchorage Island, Léonie Island and Lagoon Island) in austral summer (Jan–Feb) 2015.

Method step description:

  1. Samples were returned within 3 h of sampling to the Bonner Laboratory (Rothera Research Station, Ryder Bay, Antarctica), where they were melted in 4 °C lit incubators (Sanyo). 10 ml of snow melt was pelleted using centrifugation (2000 g for 10 min, 4 °C), after which the supernatant was discarded and the remaining algal pellet was flash frozen in liquid nitrogen and stored at -80 °C.
  2. Frozen pellets (approximately 1cm3) of field-collected algal communities from 10 ml snow melt were allowed to thaw before being resuspended in 1 ml of RNase-free water. After transferring to a clean 1.5 ml microfuge tube, the samples were ground with sterilised sand before adding another 1 ml of RNase-free water and subsequent transfer to a 15 ml capacity tube to which 3 ml of SDS-EB buffer (2% SDS, 400 mM NaCl, 40 mM EDTA, 100 mM Tris-HCl, pH8.0) were added, followed by mixing by vortexing and shaking for 5 min at 4 °C. Subsequently, 3 ml of chloroform were added, mixed gently by inversion and the whole suspension was centrifuged for 5 min at 2000 g and 4 °C, resulting in a two phase separation. The top aqueous phase was transferred to a new 15 ml capacity tube and two volumes of 100% chilled ethanol were added before incubating overnight at -20 °C.
  3. The following day, the mix was spun at 6800 g at 0 °C for 30 min. After carefully discharging the supernatant, the pellet was resuspended with 1 ml of ethanol (70%) and recovered in a clean microfuge tube before determining total RNA concentration and quality. Libraries of the fourth hypervariable (V4) domain of 16S rRNA gene and internal transcribed spacer region (ITS) of rRNA gene were produced using the NEXTflexTM “16S V4” and “18S ITS” Amplicon-Seq Library Prep Kit and primers (BIOO Scientific, Austin, TX), respectively. For consistency we hereafter use the term “ITS” for the NEXTflex 18S-ITS region. The microbial 16S rRNA gene forward primer (V4 Forward) sequence was: 5’- GACGCTCTTCCGATCTTATGGTAATTGTGTGCCAGCMGCCGCGGTAA-3’ and the reverse primer (V4 Reverse) sequence was: 5’- TGTGCTCTTCCGATCTAGTCAGTCAGCCGGACTACHVGGGTWTCTAAT-3’. The This article is protected by copyright. All rights reserved. eukaryotic ITS forward primer (18S ITS Forward) sequence CTCTTTCCCTACACGACGCTCTTCCGATCTTCCGTAGGTGAACCTGCGG-3’ reverse primer (18S ITS Forward) CTGGAGTTCAGACGTGTGCTCTTCCGATCTTCCTCCGCTTATTGATATGC-3’. Samples were sequenced by Cambridge Genomic Services (Cambridge, UK) using an Illumina MiSeq v3 600-Cycle Sequencer following the manufacturer’s protocol and primers.

Bibliographic Citations

  1. Davey, M. P., Norman, L., Sterk, P., Huete‐Ortega, M., Bunbury, F., Loh, B. K. W., ... & Smith, A. G. (2019). Snow algae communities in Antarctica–metabolic and taxonomic composition. New Phytologist.

Additional Metadata

Alternative Identifiers 3e77139d-6fbc-4e4e-86f0-ca966d398874
https://ipt.biodiversity.aq/resource?r=antarctic_snow_algae_communities