Bacteria (16S ssu rRNA) in an Antarctic snow sample

Dernière version Publié par SCAR - Microbial Antarctic Resource System le mars 19, 2019 SCAR - Microbial Antarctic Resource System
Date de publication:
19 mars 2019
Licence:
CC-BY 4.0

Téléchargez la dernière version de la ressource "Métadonnées uniquement" au format EML ou RTF :

Métadonnées sous forme de fichier EML télécharger dans Anglais (12 KB)
Métadonnées sous forme de fichier RTF télécharger dans Anglais (13 KB)

Description

Amplicon sequencing sample of Bacteria (16S ssu rRNA gene, v1-v3 region) from a snow sample taken from the "clean Area”, 2 km South from the Antarctic Research Base “Concordia” (75°06′S–123°20′E).

Versions

Le tableau ci-dessous n'affiche que les versions publiées de la ressource accessibles publiquement.

Comment citer

Les chercheurs doivent citer cette ressource comme suit:

Michaud L, Lo Giudice A, Mysara M, Monsieurs P, Raffa C, Leys N, Almafitano S, Van Houdt R (2019): Bacteria (16S ssu rRNA) in an Antarctic snow sample. v1.2. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_snow&v=1.2

Droits

Les chercheurs doivent respecter la déclaration de droits suivante:

L’éditeur et détenteur des droits de cette ressource est SCAR - Microbial Antarctic Resource System. Ce travail est sous licence Creative Commons Attribution (CC-BY) 4.0.

Enregistrement GBIF

Cette ressource a été enregistrée sur le portail GBIF, et possède l'UUID GBIF suivante : 647cb838-3294-4ee3-8ebc-a3a0075c7e5a.  SCAR - Microbial Antarctic Resource System publie cette ressource, et est enregistré dans le GBIF comme éditeur de données avec l'approbation du Scientific Committee on Antarctic Research.

Mots-clé

Metadata

Contacts

Luigi Michaud
  • Créateur
  • Personne De Contact
University of Messina
Messina
IT
Angelina Lo Giudice
  • Créateur
  • Personne De Contact
University of Messina
Messina
IT
Mohamed Mysara
  • Créateur
Vrije Universiteit Brussel
Brussels
BE
Pieter Monsieurs
  • Créateur
Belgian Nuclear Research Centre (SCK CEN)
Mol
BE
Carmella Raffa
  • Créateur
University of Messina
Messina
IT
Natalie Leys
  • Créateur
Belgian Nuclear Research Centre (SCK CEN)
Mol
BE
Stefano Almafitano
  • Créateur
National Research Council (IRSA-CNR)
Rome
IT
Rob Van Houdt
  • Créateur
Belgian Nuclear Research Centre (SCK CEN)
Mol
BE
Maxime Sweetlove
  • Fournisseur Des Métadonnées
Research assistent
Royal Belgian Institute for Natural Sciences
Rue Vautier 29
Brussels

Couverture géographique

Antarctic snow surface sample collected in the “Clean Area” 2 km South from the Research Base “Concordia” (75°06′S–123°20′E)

Enveloppe géographique Sud Ouest [-75, -123], Nord Est [-75, -123]

Couverture taxonomique

Bacteria (16S ssu rRNA gene, v1-v3 region)

Domain Bacteria (Bacteria)

Couverture temporelle

Date de début 2010-01-01

Données sur le projet

Pas de description disponible

Titre Bacteria (16S ssu rRNA) in an Antarctic snow sample
Financement Support was given by the Italian “Programma Nazionale di Richerche in Antartide” (PNRA) and the MNA (Museo Nazionale dell'Antartide)

Les personnes impliquées dans le projet:

Luigi Michaud
Angelina Lo Giudice

Méthodes d'échantillonnage

Sampling was performed by using polyethylene boxes pre-treated with 1M hydrogen chloride and hydrogen peroxide. Sterile gloves and suit, and an ethanol flame-sterilized shovel were used.

Etendue de l'étude Snow surface sample was collected in triplicate from a “Clean Area” 2 km from the Research Base “Concordia” (75°06′S–123°20′E)
Contrôle qualité Autoclave-sterilized Milli-Q water was treated in tandem with the snow samples as a negative-control field blank. Quantity and quality of extracted DNA was checked by nanodrop ND-1000 device and the Quant-iT PicoGreen dsDNA reagent and kit (Life Tech, Carlsbad, USA) following the manufacturer's instructions.

Description des étapes de la méthode:

  1. Collected samples were allowed to thaw at 4°C for 24–48 h in the laboratory, with 100 litres of packed snow per sample resulting in approximately 20 litres of snowmelt.
  2. 15 L melted snow for DNA extraction was filtered through a 0.2-µm-pore-size Sterivex filter unit (Millipore). The filters were stored at −20°C in lysis buffer (50 mM tris, 40 mM EDTA, and 750 mM sucrose).
  3. Genomic DNA was extracted in triplicate using the phenol-chloroform method according to Zhou et al., and precipitated by adding 0.7 volumes of 100% isopropanol followed by a wash with ice-cold 70% ethanol. After air-drying, DNA was resuspended in 50 µl of deionizated sterile water.
  4. PCR of a bacterial 16S rRNA gene fragment (V1–V3 region, 507 bp) and subsequent tag-encoded pyrosequencing were performed at DNAVision (Charleroi, Belgium). The 16S rRNA genes were amplified using the two universal primers 8F (5′- AGAGTTTGATCCTGGCTCAG -3′) and 518R (5′- ATTACCGCGGCTGCTGG -3′). The forward primer contained the sequence of the Titanium A adaptor (5′-CCATCTCATCCCTGCGTGTCTCCGACTCAG-3′) and a barcode sequence. For each sample, a PCR mix of 100 µl was prepared containing 1×PCR buffer, 2U of KAPA HiFi Hotstart polymerase blend and dNTPs (Kapabiosystems), 300 nM primers (Eurogentec, Liege, Belgium), and 60 ng gDNA. Thermal cycling consisted of initial denaturation at 95°C for 5 min, followed by 25 cycles of denaturation at 98°C for 20 s, annealing at 56°C for 40 s, and extension at 72°C for 20 s, with a final extension of 5 min at 72°C. 3 µl of PCR product were added to a new PCR mix (identical as first round of PCR) for the nested PCR of 15 cycles. Amplicons were visualized on 1% agarose gels using GelGreen Nucleic Acid gel stain in 1× TAE (Biotium) and were cleaned using the Wizard SV Gel and PCR Clean-up System (Promega) according to the manufacturer's instructions. Pyrosequencing was carried out using the forward primer on a 454 Life Sciences Genome Sequencer FLX instrument (Roche) following titanium chemistry.

Citations bibliographiques

  1. Michaud, L., Giudice, A. L., Mysara, M., Monsieurs, P., Raffa, C., Leys, N., ... & Van Houdt, R. (2014). Snow surface microbiome on the High Antarctic Plateau (DOME C). PloS one, 9(8), e104505.

Métadonnées additionnelles

Identifiants alternatifs 647cb838-3294-4ee3-8ebc-a3a0075c7e5a
https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_snow