Bacteria (16S) in Antarctic terrestrial soils of the Sor Rondane Mountains
Versão mais recente publicado por SCAR - Microbial Antarctic Resource System em Mar 19, 2019
Illumina sequencing data of bacterial communities in 52 soil samples from the western Sør Rondane Mountains (Dronning Maud Land, East Antarctica).The samples were taken along broad environmental gradients, including different types of bedrock, in an area covering nearly 1000 km2.
Versões
A tabela abaixo mostra apenas versões de recursos que são publicamente acessíveis.
Como citar
Pesquisadores deveriam citar esta obra da seguinte maneira:
Tytgat B, Vyverman W, Willems A, Verleyen E (2018): Bacteria (16S) in Antarctic terrestrial soils of the Sor Rondane Mountains. v1.4. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_terrestrial_soils&v=1.4
Direitos
Pesquisadores devem respeitar a seguinte declaração de direitos:
O editor e o detentor dos direitos deste trabalho é SCAR - Microbial Antarctic Resource System. This work is licensed under a Creative Commons Attribution (CC-BY) 4.0 License.
GBIF Registration
Este recurso foi registrado no GBIF e atribuído ao seguinte GBIF UUID: fcef9fcc-f737-46a1-b44e-edde5c5789a2. SCAR - Microbial Antarctic Resource System publica este recurso, e está registrado no GBIF como um publicador de dados aprovado por Scientific Committee on Antarctic Research.
Palavras-chave
Metadata
Contatos
Quem criou esse recurso:
Quem pode responder a perguntas sobre o recurso:
Quem preencher os metadados:
Quem mais foi associado com o recurso:
Cobertura Geográfica
Sor Ronda Mountains, East Antarctica
| Coordenadas delimitadoras | Sul Oeste [-72.1, 22.7], Norte Leste [-71.8, 24.6] |
|---|
Cobertura Taxonômica
16S ssh rRNA gene of Bacteria, using the primers pA (AGAGTTTGATCCTGGCTCAG, positions 8–27) and BKL1 (GTATTACCGCGGCTGCTGGCA, positions 536–516)
| Domínio | Bacteria (bacteria) |
|---|
Cobertura Temporal
| Data Inicial / Data final | 2009-01-01 / 2010-01-01 |
|---|
Dados Sobre o Projeto
Nenhuma descrição disponível
| Título | BELDIVA-AMBIO |
|---|---|
| Financiamento | This research was funded by the Special Research Fund BOF of (grant ) and by the Belgian Science Policy Office (BelSPO) projects BELDIVA (EA/00/05), AMBIO (SD/BA/01A) and CCAMBIO (SD/BA/03A). A. Wilmotte is Research Associate of the FRS-FNRS. This study is a contribution to the State of the Antarctic Ecosystem (AntEco) research program of the Scientific Committee on Antarctic Research (SCAR). |
| Descrição da Área de Estudo | The Sop Ronda Mountains (SRM) (22° E-28° E, 71°30′ S-72°40′ S) are a 220 km long, east-west oriented mountain range, situated about 200 km inland, with peaks reaching 3300 m a.s.l. The bedrock is mainly metamorphic (e.g. gneiss) with some plutonic (granite) outcrops. |
O pessoal envolvido no projeto:
Citações bibliográficas
- Tytgat, B., Verleyen, E., Sweetlove, M., D'hondt, S., Clercx, P., Van Ranst, E., ... & Vyverman, W. (2016). Bacterial community composition in relation to bedrock type and macrobiota in soils from the Sør Rondane Mountains, East Antarctica. FEMS microbiology ecology, 92(9).
Metadados Adicionais
| Identificadores alternativos | fcef9fcc-f737-46a1-b44e-edde5c5789a2 |
|---|---|
| https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_terrestrial_soils |