Bacterial Diversity Assessment in Antarctic Terrestrial and Aquatic Microbial Mats

Última versión Publicado por SCAR - Microbial Antarctic Resource System en Mar 19, 2019 SCAR - Microbial Antarctic Resource System

Bacterial data (16S rRNA) from terrestrial and aquatic Microbial mats in continental Antarctic.

Descargas

Descargue la última versión de los metadatos como EML o RTF:

Metadatos como un archivo EML descargar en Inglés (15 KB)
Metadatos como un archivo RTF descargar en Inglés (13 KB)

Versiones

La siguiente tabla muestra sólo las versiones publicadas del recurso que son de acceso público.

¿Cómo referenciar?

Los usuarios deben citar este trabajo de la siguiente manera:

Tytgat B, Vrleyen E, Obbels D, Peeters K, De Wever A, D'hondt S, De Meyer T, van Criekinge W, Vyverman W, Willems A (2018): Bacterial Diversity Assessment in Antarctic Terrestrial and Aquatic Microbial Mats. v1.1. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=bacterial_diversity_antarctica_microbial_mats&v=1.1

Derechos

Los usuarios deben respetar los siguientes derechos de uso:

El publicador y propietario de los derechos de este trabajo es SCAR - Microbial Antarctic Resource System. This work is licensed under a Creative Commons Attribution (CC-BY) 4.0 License.

Registro GBIF

Este recurso ha sido registrado en GBIF con el siguiente UUID: f3a8b1d6-a1d1-4292-8a7e-19c63a0825bd.  SCAR - Microbial Antarctic Resource System publica este recurso, y está registrado en GBIF como un publicador de datos avalado por Scientific Committee on Antarctic Research.

Palabras Clave

lake; soil; bacteria; antarctica; 16S

Contactos

¿Quién creó el recurso?:

Bjorn Tytgat
Post doctoral assistent
Ghent University Krijgslaan 281 9000 Gent BE
Elie Vrleyen
Professor
Ghent University Krijgslaan 281 9000 Gent BE
Dagmar Obbels
PhD student
Ghent University Krijgslaan 281 9000 Gent BE
Karolien Peeters
Post doctoral researcher
Ghent University Krijgslaan 281 9000 Gent BE
Aake De Wever
Post doctoral assistent
Royal Belgian Institute for Natural Sciences Krijgslaan 281 1000 Brussels BE
Sofie D'hondt
Lab technician
Ghent University
Tim De Meyer
Professor
Ghent University
Wim van Criekinge
Post doctoral researcher
GhentUniversity
Wim Vyverman
Professor
Ghent University
Anne Willems
Professor
Ghent Univeristy

¿Quién puede resolver dudas acerca del recurso?:

Bjorn Tytgat
Post doctoral assistent
Ghent University Krijgslaan 281 9000 Gent BE

¿Quién documentó los metadatos?:

Maxime Sweetlove
Royal Belgian Institute for Natural Sciences Rue Vautier 29 1000 Brussels BE

¿Quién más está asociado con el recurso?:

Proveedor de Contenido
Bjorn Tytgat
Post doctoral assistent
Ghent University Krijgslaan 281 9000 Gent BE
Proveedor de Contenido
Karolien Peeters
Post doctoral researcher
Ghent University 9000 Gent BE
Proveedor de Contenido
Anne Willems
Professor
Ghent University 9000 Gent BE

Cobertura Geográfica

soil samples and lake samples from East Antarctica

Coordenadas límite Latitud Mínima Longitud Mínima [-80.45, -67.45], Latitud Máxima Longitud Máxima [-67.7, 39.8]

Cobertura Taxonómica

Bacterial 16S amplicons (V1-V3 region)

Dominio  Bacteria (Bacteria)

Cobertura Temporal

Fecha Inicial / Fecha Final 2003-01-01 / 2007-01-01

Datos del Proyecto

CCAMBIO (Climate Change and Antarctic Microbial Biodiversity) is an academic project funded by the Belgian Federal Science Policy (BELSPO). Its main objective is to study the diversity, biogeographic zoning and genomic make-up of lacustrine microbial mat communities in the Antarctic Realm. CCAMBIO is composed by researchers from four Belgian Universities and Institutes (University of Liège, Ghent University, National Botanical Garden of Belgium and Royal Belgian Institute of Natural Sciences), as well as collaborators from the British Antarctic Survey.

Título CCAMBIO
Identificador CCAMBIO
Fuentes de Financiación Belgian Science Policy Office (BelSPO) project SD/BA/03

Personas asociadas al proyecto:

Bjorn Tytgat
Elie Verleyen
Dagmar Obbels
Anne Willems
Wim Vyverman

Métodos de Muestreo

Two terrestrial and seven limnetic microbial mat samples were collected aseptically during different field campaigns in December/January 2003 (PQ1, TM2 and TM4) and in January 2007 (BB50, BB115, LA3, SK5, WO10 and SO6). All samples were kept frozen during transport and stored at 220uC.

Área de Estudio One sample (PQ1) was collected on Pourquoi-Pas Island off the west coast of Graham Land (Antarctic Peninsula). All other samples were collected from Eastern Antarctic habitats. The two terrestrial microbial mat samples (BB50 and BB115) were taken near the Utsteinen nunatak in the Sør Rondane Mountains (Dronning Maud Land). Three samples were from Lu ̈tzow-Holm Bay (Dronning Maud Land), namely from a small saline lake in Langhovde (LA3), from Naka-Tempyo Lake (SK5) in Skarvsnes, and from a small saline pond (WO10) in West Ongul Island. One sample (SO6) was taken from Lake Melkoye (unofficial name) in Schirmacher Oasis (Dronning Maud Land). The two remaining samples were collected in the Transantarctic Mountains. Sample TM2 was taken from Forlidas Pond (Dufek Massif, Pensacola Mountains), while sample TM4 was taken from Lundstro ̈m Lake (Shackleton Range).

Descripción de la metodología paso a paso:

  1. DNA was extracted from frozen samples using 5 g per sample. Extracellular DNA was first removed as described by Corinaldesi et al. and DNA extraction was subsequently performed according to Zwart et al. Sequencing of the 16S rRNA V1–V3 regions was performed using forward primer pA (AGAGTTTGATCCTGGCTCAG 8–27) and reverse primer BKL1 (GTATTACCGCGGCTGCTGGCA 536– 516). Because it proved impossible to concatenate the comple- mentary reads due to insufficient overlap, the forward and reverse sequences were analyzed separately. The forward reads hence cover the complete V1 and V2 regions, whereas the reverse reads cover the V3 and part of the V2 region for the longest sequences.
  2. Multiplexing was done with barcodes proposed by Parames- waran et al. Each PCR mixture contained 1–2 ml of template DNA, 2 ml of fusion primers and barcodes (10 mM), 2.5 ml dNTPs (10 mM), 1.5 ml of 10x buffer, 0.25 ml of 5 U/ml FastStart High Fidelity Polymerase (Roche) and was adjusted to a final volume of 25 ml with sterile HPLC-water. PCR cycling included 3 min at 94uC, followed by 35 cycles of 94uC for 30 s, 55uC for 60 s and 72uC for 90 s and finally 8 min at 72uC. PCR products were purified using a High Pure PCR Product Purification Kit (Roche).
  3. Pyrosequencing was performed on a Roche 454 GS FLX Titanium machine at NXTGNT (Ghent, Belgium) after quality control of the DNA with a Qubit 2.0 Fluorometer (Life Technologies) and a Bioanalyzer (Agilent Technologies).

Referencias Bibliográficas

  1. Tytgat, B., Verleyen, E., Obbels, D., Peeters, K., De Wever, A., D’hondt, S., ... & Willems, A. (2014). Bacterial diversity assessment in Antarctic terrestrial and aquatic microbial mats: a comparison between bidirectional pyrosequencing and cultivation. PloS one, 9(6), e97564.

Metadatos Adicionales

Identificadores Alternativos f3a8b1d6-a1d1-4292-8a7e-19c63a0825bd
https://ipt.biodiversity.aq/resource?r=bacterial_diversity_antarctica_microbial_mats