Descripción
Amplicon sequencing dataset (Illumina MiSeq) of Bacteria (16S ssu rRNA gene) in soil samples from the McMurdo Dry Valleys (Antarctica) taken along a moisture gradient.
Versiones
La siguiente tabla muestra sólo las versiones publicadas del recurso que son de acceso público.
¿Cómo referenciar?
Los usuarios deben citar este trabajo de la siguiente manera:
Lee K, Caruso T, Archer S, Gillman L, Lau M, Cary C, lee C, Pointing S (2019): Microbial population dynamics along a terrestrial Antarctic moisture gradient. v1.2. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=microbes_terrestrial_antarctic_moisture_gradient&v=1.2
Derechos
Los usuarios deben respetar los siguientes derechos de uso:
El publicador y propietario de los derechos de este trabajo es SCAR - Microbial Antarctic Resource System. Esta obra está bajo una licencia Creative Commons de Atribución/Reconocimiento (CC-BY 4.0).
Registro GBIF
Este recurso ha sido registrado en GBIF con el siguiente UUID: f1516a8a-2f31-4215-b6df-7cdb37c98655. SCAR - Microbial Antarctic Resource System publica este recurso y está registrado en GBIF como un publicador de datos avalado por Scientific Committee on Antarctic Research.
Palabras clave
Metadata
Contactos
- Originador ●
- Punto De Contacto
- Originador
- Originador
- Originador
- Originador
- Originador
- Originador
- Originador
- Proveedor De Los Metadatos
Cobertura geográfica
McMurdo Dry Valleys, Victoria lands, Antarctica
Coordenadas límite | Latitud Mínima Longitud Mínima [-77,66, 163,105], Latitud Máxima Longitud Máxima [-77,658, 163,127] |
---|
Cobertura taxonómica
Bacteria, based on amplicon sequencing of the 16S ssu rRNA marker gene (v3-v4region)
Dominio | Bacteria (Bacteria) |
---|
Cobertura temporal
Fecha Inicial | 2015-01-01 |
---|
Datos del proyecto
No hay descripción disponible
Título | Microbial population dynamics along a terrestrial Antarctic moisture gradient |
---|---|
Fuentes de Financiación | The research was funded by a grant from the New Zealand Ministry of Business, Innovation & Employment (UOWX1401) and Yale-NUS College Start-Up Fund. |
Personas asociadas al proyecto:
Métodos de muestreo
We adopted a zonal sampling approach where soils were retrieved that matched visible delineations along linear transects extending across the hyporheic zone from the water’s edge at each sampling station: Zone (1) Saturated soil adjacent to water’s edge; Zone (2) Wet soil as indicated by dark coloration; Zone (3) Ephemerally wet soil, dry but with evidence for previous water indicated by surface evaporites; Zone (4) Dry soil with no indication of recent moisture. Soils from each zone in each transect were recovered using aseptic technique and saturated with Lifeguard solution (Qiagen, Netherlands) (n = 16) with parallel sampling for geochemical and moisture analysis (n = 16). All samples were stored in darkness frozen at -20oC until processed.
Área de Estudio | Sampling was conducted around the hyporheic zone of Spaulding Pond, Taylor Valley in the McMurdo Dry Valleys of Antarctica, during the austral summer of 2015. Four transects were defined in north-east (S77◦ 39.489′ , E163◦ 07.501′ ), south-east (S77◦ 39.513′ , E◦ 163 07.626′ ), south (S77◦ 39.589′ , E◦ 163 07.006′ ), and north-west (S77◦ 39.470′, E◦163 06.336′) facing hyporheic moisture gradients. |
---|
Descripción de la metodología paso a paso:
- Samples were thawed on ice and three 0.5 g extractions were conducted using the CTAB method optimized for Antarctic oligotrophic environmental samples (Archer et al., 2015). DNA yield was measured in ng/g soil. Illumina MiSeq libraries were prepared as per manufacturer’s protocol (Metagenomic Sequencing Library Preparation Part # 15044223 Rev. B; Illumina, San Diego, CA, United States) as previously described (Lee et al., 2016). PCR targeting the V3–V4 regions of bacterial and archaeal 16S rRNA gene with the primer set: PCR1 forward (5′ TCGTCGGCAGCGTCAGATGT GTATAAGAGA CAGCCTACGG GNGGCWGCAG 3′ ) and PCR1 reverse (5′ GTCTCGTGGG CTCGGAGATG TGTATAAGAG ACAGGACTAC HVGGGTATCT AATCC 3′) was conducted using KAPA HiFi Hotstart Readymix (Kapa Biosystems, Wilmington, MA, United States) and the following thermocycles: (1) 95◦C for 3 min, (2) 25 cycles of 95◦C for 30 s, 55◦C for 30 s, ◦C for 30 s, 72◦C for 5 min, and (3) holding the samples at 4◦C. The amplicons were then indexed using Nextera XT index kit (Illumina). AMPure XP beads (Beckman-Coulter, Brea, CA, United States) was used to purified the amplicon. Sequencing was conducted with an Illumina MiSeq system (Illumina) with the 500 cycle V2chemistry at Auckland University of Technology, New Zealand. A 5% PhiX spike-in was used, as per manufacturer’s recommendation.
Referencias bibliográficas
- Lee, K. C., Archer, S. D. J., Caruso, T., Gillman, L., Lau, M. C., Cary, S. C., ... & Pointing, S. B. (2018). Stochastic and deterministic effects of a moisture gradient on soil microbial communities in the McMurdo Dry Valleys of Antarctica. Frontiers in Microbiology, 9, 2619.
Metadatos adicionales
Identificadores alternativos | f1516a8a-2f31-4215-b6df-7cdb37c98655 |
---|---|
https://ipt.biodiversity.aq/resource?r=microbes_terrestrial_antarctic_moisture_gradient |