Descrição
Amplicon sequencing dataset (454) of microbial fungi (ITS2 marker gene) in soils from the Antarctic Peninsula and Maritime Antarctic Islands.
Versões
A tabela abaixo mostra apenas versões de recursos que são publicamente acessíveis.
Como citar
Pesquisadores deveriam citar esta obra da seguinte maneira:
Newsham K, Hopkins D, Carvalhais L, Fretwell P, Rushton S, O'Donnell A, Dennis P (2019): Microbial soil Fungi (ITS2) diversity from Maritime Antarctica. v1.2. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=soil_fungi_its2_maritime_antarctica&v=1.2
Direitos
Pesquisadores devem respeitar a seguinte declaração de direitos:
O editor e o detentor dos direitos deste trabalho é SCAR - Microbial Antarctic Resource System. This work is licensed under a Creative Commons Attribution (CC-BY 4.0) License.
GBIF Registration
Este recurso foi registrado no GBIF e atribuído ao seguinte GBIF UUID: 7c5815a5-7909-418b-87dc-af0cab0e57ce. SCAR - Microbial Antarctic Resource System publica este recurso, e está registrado no GBIF como um publicador de dados aprovado por Scientific Committee on Antarctic Research.
Palavras-chave
Metadata
Contatos
- Originador ●
- Ponto De Contato
- Originador
- Originador
- Originador
- Originador
- Originador
- Originador ●
- Ponto De Contato
- Provedor Dos Metadados
- Research assistent
- Rue Vautier 29
Cobertura Geográfica
Soil samples from the Antarctic Peninsula and Maritime Antarctic Islands.
| Coordenadas delimitadoras | Sul Oeste [-71,878, -71,844], Norte Leste [-60,701, -45,661] |
|---|
Cobertura Taxonômica
microbial soil Fungi, ITS2 marker gene
| Filo | Fungi (Fungi) |
|---|
Dados Sobre o Projeto
Nenhuma descrição disponível
| Título | Microbial soil Fungi (ITS2) diversity from Maritime Antarctica |
|---|---|
| Financiamento | This work was funded by a UK Natural Environment Research Council Antarctic Funding Initiative grant (NE/D00893X/1; AFI 7/05) and a University of Queensland Early Career Researcher Award. |
O pessoal envolvido no projeto:
Métodos de Amostragem
The uppermost five centimetres of soil was collected in 50 ml DNA/RNAase-treated plastic tubes (30 mm diam.) from each of five locations at each site and was bulked. The soil was then immediately snap-frozen by immersion in a mixture of dry ice and ethanol (c. -80 °C). Samples were maintained at -80 °C from the time of sampling until they were processed.
| Área de Estudo | Soils without plant cover were sampled along the climatic gradient in Maritime Antarctica. |
|---|
Descrição dos passos do método:
- Total DNA was extracted under sterile conditions from 10 g of soil using a PowerMax® Soil DNA isolation kit (MO BIO Laboratories, Inc., Carlsbad, CA, USA) as per the manufacturer’s instructions. The internal transcribed spacer 2 (ITS2) region of the ribosomal RNA encoding genes was amplified by polymerase chain reaction (PCR) using the primers gITS7 (5′ GTGARTCATCGARTCTTTG27) and ITS4 (5′ TCCTCCGCTTATTGATATGC28), which target sites in the 5.8S gene and ribosomal large subunit, respectively. The gITS7 primer was 5’-labelled with the 454 FLX sequencing primer adapter B sequence and the ITS4 primer was 5’-labelled with a sample specific barcode sequence and the 454 FLX sequencing primer adapter A sequence. PCRs were performed in duplicate 50 μl reactions, each containing 5 ng template DNA, 1X Phusion® High Fidelity PCR Buffer (New England Biolabs Inc.), 0.2 mM of each of the dNTPs (Invitrogen), 0.3 μM of the ITS4 primer, 0.5 μM of the gITS7 primer, and 1U of 1X Phusion® High Fidelity DNA Polymerase (New England Biolabs Inc.). Thermocycling conditions were as follows: 98 °C for 30 s, 35 cycles of 98 °C for 10 s, 56 °C for 30 s, 72 °C for 15 s and a final extension at 72 °C for 7 min. Negative controls, consisting of sterile water in place of template DNA, did not yield amplicons. Amplicons were purified using a Wizard® SV Gel and PCR Clean-Up System (Promega), quantified with a Qubit fluorometer with a Quant-iT dsDNA HF assay kit and then 72 ng of each sample was pooled. The pooled sample was purified again using a QIAquick PCR Purification Kit (Qiagen), and then sent to Macrogen (Seoul, Korea) for 454 pyrosequencing.
Citações bibliográficas
- Newsham, K. K., Hopkins, D. W., Carvalhais, L. C., Fretwell, P. T., Rushton, S. P., O’Donnell, A. G., & Dennis, P. G. (2016). Relationship between soil fungal diversity and temperature in the maritime Antarctic. Nature Climate Change, 6(2), 182.
Metadados Adicionais
| Identificadores alternativos | 7c5815a5-7909-418b-87dc-af0cab0e57ce |
|---|---|
| https://ipt.biodiversity.aq/resource?r=soil_fungi_its2_maritime_antarctica |