Solamente metadatos

Antarctic snow algae communities

Última versión Publicado por SCAR - Microbial Antarctic Resource System en 19 de marzo de 2019 SCAR - Microbial Antarctic Resource System
Fecha de publicación:
19 de marzo de 2019
Licencia:
CC-BY 4.0

Descargue la última versión de los metadatos como EML o RTF:

Metadatos como un archivo EML descargar en Inglés (12 KB)
Metadatos como un archivo RTF descargar en Inglés (13 KB)

Descripción

Amplicon sequencing dataset of Eukaryotes (18S-ITS) and Bacteria (16S) in green and red snow algae blooms on Antarctic snow.

Versiones

La siguiente tabla muestra sólo las versiones publicadas del recurso que son de acceso público.

¿Cómo referenciar?

Los usuarios deben citar este trabajo de la siguiente manera:

Davey M, Norman L, Sterk P, Huete-Ortega M, BunBury F, Kin Wai Loh B, Peck L, Conevy P, Newsham K, Smith A (2019): Antarctic snow algae communities. v1.1. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=antarctic_snow_algae_communities&v=1.1

Derechos

Los usuarios deben respetar los siguientes derechos de uso:

El publicador y propietario de los derechos de este trabajo es SCAR - Microbial Antarctic Resource System. Este trabajo está autorizado bajo una Licencia Creative Commons Atribución/Reconocimiento 4.0 Internacional (CC-BY) 4.0.

Registro GBIF

Este recurso ha sido registrado en GBIF con el siguiente UUID: 3e77139d-6fbc-4e4e-86f0-ca966d398874.  SCAR - Microbial Antarctic Resource System publica este recurso y está registrado en GBIF como un publicador de datos avalado por Scientific Committee on Antarctic Research.

Palabras clave

Metadata

Contactos

¿Quién creó el recurso?:
-

Matthew Davey
University of Cambridge
Cambridge
GB
Louisa Norman
University of Cambridge
Cambridge
GB
Peter Sterk
University of Cambridge
Cambridge
GB
Maria Huete-Ortega
University of Cambridge
Cambridge
GB
Freddy BunBury
University of Cambridge
Cambridge
GB
Bradford Kin Wai Loh
University of Cambridge
Cambridge
GB
Lloyd Peck
British Antarctic Survey
Cambridge
GB
Peter Conevy
British Antarctic Survey
Cambridge
GB
Kevin Newsham
British Antarctic Survey
Cambridge
GB
Alison Smith
University of Cambridge
Cambridge
GB

¿Quién puede resolver dudas acerca del recurso?:

Matthew Davey
University of Cambridge
Cambridge
GB

¿Quién documentó los metadatos?:
-

Maxime Sweetlove
Research assistent
Royal Belgian Institute of Natural Sciences
Rue Vautier 29
1000 Brussels
BE

¿Quién más está asociado con el recurso?:

Usuario

Cobertura geográfica

Rothera Point, Anchorage Island, Léonie Island and Lagoon Island: Ryder Bay: Antarctic Peninsula

Coordenadas límite Latitud Mínima Longitud Mínima [-67,586, -68,133], Latitud Máxima Longitud Máxima [-67,586, -68,133]

Cobertura taxonómica

Bacteria (16S ssu rRNA marker gene)

Dominio Bacteria (Bacteria)

Eukaryotes (18S ssu rRNA- ITS marker)

Dominio Eukarya (Eukaryotes)

Cobertura temporal

Periodo de formación 2015-01/02

Datos del proyecto

No hay descripción disponible

Título Antarctic snow algae communities
Fuentes de Financiación The research expedition was funded by a NERC Collaborative Gearing Scheme award (RJCGS14MPD) in 2014/15. Additional support was given by the European Union (project no. 215G) INTERREG IVB ‘Energetic Algae’ (EnAlgae) program and a Leverhulme Trust Research Grant (RPG-2017-077). The metabarcoding analysis was supported by a Collaboration Voucher from the British Antarctic Survey and carried out by the Cambridge Genomic Services (University of Cambridge, Department of Pathology).

Personas asociadas al proyecto:

Matthew Davey

Métodos de muestreo

Snow samples were (1-5cm depth) taken in 6 x 50 ml sterile plastic sample tubes. The algae were collected by filling a sterile 50 ml tube with snow, which was not compacted.

Área de Estudio Snow algae communities were collected from layers of green and red dominant snow algal blooms at four locations in Ryder Bay, Antarctic Peninsula (Rothera Point, Anchorage Island, Léonie Island and Lagoon Island) in austral summer (Jan–Feb) 2015.

Descripción de la metodología paso a paso:

  1. Samples were returned within 3 h of sampling to the Bonner Laboratory (Rothera Research Station, Ryder Bay, Antarctica), where they were melted in 4 °C lit incubators (Sanyo). 10 ml of snow melt was pelleted using centrifugation (2000 g for 10 min, 4 °C), after which the supernatant was discarded and the remaining algal pellet was flash frozen in liquid nitrogen and stored at -80 °C.
  2. Frozen pellets (approximately 1cm3) of field-collected algal communities from 10 ml snow melt were allowed to thaw before being resuspended in 1 ml of RNase-free water. After transferring to a clean 1.5 ml microfuge tube, the samples were ground with sterilised sand before adding another 1 ml of RNase-free water and subsequent transfer to a 15 ml capacity tube to which 3 ml of SDS-EB buffer (2% SDS, 400 mM NaCl, 40 mM EDTA, 100 mM Tris-HCl, pH8.0) were added, followed by mixing by vortexing and shaking for 5 min at 4 °C. Subsequently, 3 ml of chloroform were added, mixed gently by inversion and the whole suspension was centrifuged for 5 min at 2000 g and 4 °C, resulting in a two phase separation. The top aqueous phase was transferred to a new 15 ml capacity tube and two volumes of 100% chilled ethanol were added before incubating overnight at -20 °C.
  3. The following day, the mix was spun at 6800 g at 0 °C for 30 min. After carefully discharging the supernatant, the pellet was resuspended with 1 ml of ethanol (70%) and recovered in a clean microfuge tube before determining total RNA concentration and quality. Libraries of the fourth hypervariable (V4) domain of 16S rRNA gene and internal transcribed spacer region (ITS) of rRNA gene were produced using the NEXTflexTM “16S V4” and “18S ITS” Amplicon-Seq Library Prep Kit and primers (BIOO Scientific, Austin, TX), respectively. For consistency we hereafter use the term “ITS” for the NEXTflex 18S-ITS region. The microbial 16S rRNA gene forward primer (V4 Forward) sequence was: 5’- GACGCTCTTCCGATCTTATGGTAATTGTGTGCCAGCMGCCGCGGTAA-3’ and the reverse primer (V4 Reverse) sequence was: 5’- TGTGCTCTTCCGATCTAGTCAGTCAGCCGGACTACHVGGGTWTCTAAT-3’. The This article is protected by copyright. All rights reserved. eukaryotic ITS forward primer (18S ITS Forward) sequence CTCTTTCCCTACACGACGCTCTTCCGATCTTCCGTAGGTGAACCTGCGG-3’ reverse primer (18S ITS Forward) CTGGAGTTCAGACGTGTGCTCTTCCGATCTTCCTCCGCTTATTGATATGC-3’. Samples were sequenced by Cambridge Genomic Services (Cambridge, UK) using an Illumina MiSeq v3 600-Cycle Sequencer following the manufacturer’s protocol and primers.

Referencias bibliográficas

  1. Davey, M. P., Norman, L., Sterk, P., Huete‐Ortega, M., Bunbury, F., Loh, B. K. W., ... & Smith, A. G. (2019). Snow algae communities in Antarctica–metabolic and taxonomic composition. New Phytologist.

Metadatos adicionales

Identificadores alternativos 3e77139d-6fbc-4e4e-86f0-ca966d398874
https://ipt.biodiversity.aq/resource?r=antarctic_snow_algae_communities