Antarctic snow algae communities

Версия 1.0 опубликовано SCAR - Microbial Antarctic Resource System фев 5, 2019 SCAR - Microbial Antarctic Resource System
Дата публикации:
5 февраля 2019 г.
Опубликовано:
SCAR - Microbial Antarctic Resource System
Лицензия:
CC-BY 4.0

Скачайте последнюю версию метаданных ресурса (только метаданные) в формате EML или RTF:

Метаданные в формате EML Скачать в English (12 KB)
Метаданные в формате RTF Скачать в English (13 KB)

Описание

Amplicon sequencing dataset of Eukaryotes (18S-ITS) and Bacteria (16S) in green and red snow algae blooms on Antarctic snow.

Версии

В таблице ниже указаны только опубликованные версии ресурса, которые доступны для свободного скачивания.

Как оформить ссылку

Пожалуйста, имейте в виду, это старая версия набора данных.  Исследователи должны дать ссылку на эту работу следующим образом:

Davey M, Norman L, Sterk P, Huete-Ortega M, BunBury F, Kin Wai Loh B, Peck L, Conevy P, Newsham K, Smith A (2019): Antarctic snow algae communities. v1.0. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. http://ipt.biodiversity.aq/resource?r=antarctic_snow_algae_communities&v=1.0

Права

Исследователи должны соблюдать следующие права:

Публикующей организацией и владельцем прав на данную работу является SCAR - Microbial Antarctic Resource System. Эта работа находится под лицензией Creative Commons Attribution (CC-BY 4.0).

Регистрация в GBIF

Этот ресурс был зарегистрирован в GBIF, ему был присвоен следующий UUID: 3e77139d-6fbc-4e4e-86f0-ca966d398874.  SCAR - Microbial Antarctic Resource System отвечает за публикацию этого ресурса, и зарегистрирован в GBIF как издатель данных при оподдержке Scientific Committee on Antarctic Research.

Ключевые слова

Metadata

Контакты

Matthew Davey
  • Originator
  • Point Of Contact
University of Cambridge
Cambridge
GB
Louisa Norman
  • Originator
University of Cambridge
Cambridge
GB
Peter Sterk
  • Originator
University of Cambridge
Cambridge
GB
Maria Huete-Ortega
  • Originator
University of Cambridge
Cambridge
GB
Freddy BunBury
  • Originator
University of Cambridge
Cambridge
GB
Bradford Kin Wai Loh
  • Originator
University of Cambridge
Cambridge
GB
Lloyd Peck
  • Originator
British Antarctic Survey
Cambridge
GB
Peter Conevy
  • Originator
British Antarctic Survey
Cambridge
GB
Kevin Newsham
  • Originator
British Antarctic Survey
Cambridge
GB
Alison Smith
  • Originator
University of Cambridge
Cambridge
GB
Maxime Sweetlove
  • Metadata Provider
Research assistent
Royal Belgian Institute of Natural Sciences
Rue Vautier 29
1000 Brussels
BE

Географический охват

Rothera Point, Anchorage Island, Léonie Island and Lagoon Island: Ryder Bay: Antarctic Peninsula

Ограничивающие координаты Юг Запад [-67,586, -68,133], Север Восток [-67,586, -68,133]

Таксономический охват

Bacteria (16S ssu rRNA marker gene)

Domain Bacteria (Bacteria)

Eukaryotes (18S ssu rRNA- ITS marker)

Domain Eukarya (Eukaryotes)

Временной охват

Период формирования 2015-01/02

Данные проекта

Описание отсутсвует

Название Antarctic snow algae communities
Финансирование The research expedition was funded by a NERC Collaborative Gearing Scheme award (RJCGS14MPD) in 2014/15. Additional support was given by the European Union (project no. 215G) INTERREG IVB ‘Energetic Algae’ (EnAlgae) program and a Leverhulme Trust Research Grant (RPG-2017-077). The metabarcoding analysis was supported by a Collaboration Voucher from the British Antarctic Survey and carried out by the Cambridge Genomic Services (University of Cambridge, Department of Pathology).

Исполнители проекта:

Matthew Davey

Методы сбора

Snow samples were (1-5cm depth) taken in 6 x 50 ml sterile plastic sample tubes. The algae were collected by filling a sterile 50 ml tube with snow, which was not compacted.

Охват исследования Snow algae communities were collected from layers of green and red dominant snow algal blooms at four locations in Ryder Bay, Antarctic Peninsula (Rothera Point, Anchorage Island, Léonie Island and Lagoon Island) in austral summer (Jan–Feb) 2015.

Описание этапа методики:

  1. Samples were returned within 3 h of sampling to the Bonner Laboratory (Rothera Research Station, Ryder Bay, Antarctica), where they were melted in 4 °C lit incubators (Sanyo). 10 ml of snow melt was pelleted using centrifugation (2000 g for 10 min, 4 °C), after which the supernatant was discarded and the remaining algal pellet was flash frozen in liquid nitrogen and stored at -80 °C.
  2. Frozen pellets (approximately 1cm3) of field-collected algal communities from 10 ml snow melt were allowed to thaw before being resuspended in 1 ml of RNase-free water. After transferring to a clean 1.5 ml microfuge tube, the samples were ground with sterilised sand before adding another 1 ml of RNase-free water and subsequent transfer to a 15 ml capacity tube to which 3 ml of SDS-EB buffer (2% SDS, 400 mM NaCl, 40 mM EDTA, 100 mM Tris-HCl, pH8.0) were added, followed by mixing by vortexing and shaking for 5 min at 4 °C. Subsequently, 3 ml of chloroform were added, mixed gently by inversion and the whole suspension was centrifuged for 5 min at 2000 g and 4 °C, resulting in a two phase separation. The top aqueous phase was transferred to a new 15 ml capacity tube and two volumes of 100% chilled ethanol were added before incubating overnight at -20 °C.
  3. The following day, the mix was spun at 6800 g at 0 °C for 30 min. After carefully discharging the supernatant, the pellet was resuspended with 1 ml of ethanol (70%) and recovered in a clean microfuge tube before determining total RNA concentration and quality. Libraries of the fourth hypervariable (V4) domain of 16S rRNA gene and internal transcribed spacer region (ITS) of rRNA gene were produced using the NEXTflexTM “16S V4” and “18S ITS” Amplicon-Seq Library Prep Kit and primers (BIOO Scientific, Austin, TX), respectively. For consistency we hereafter use the term “ITS” for the NEXTflex 18S-ITS region. The microbial 16S rRNA gene forward primer (V4 Forward) sequence was: 5’- GACGCTCTTCCGATCTTATGGTAATTGTGTGCCAGCMGCCGCGGTAA-3’ and the reverse primer (V4 Reverse) sequence was: 5’- TGTGCTCTTCCGATCTAGTCAGTCAGCCGGACTACHVGGGTWTCTAAT-3’. The This article is protected by copyright. All rights reserved. eukaryotic ITS forward primer (18S ITS Forward) sequence CTCTTTCCCTACACGACGCTCTTCCGATCTTCCGTAGGTGAACCTGCGG-3’ reverse primer (18S ITS Forward) CTGGAGTTCAGACGTGTGCTCTTCCGATCTTCCTCCGCTTATTGATATGC-3’. Samples were sequenced by Cambridge Genomic Services (Cambridge, UK) using an Illumina MiSeq v3 600-Cycle Sequencer following the manufacturer’s protocol and primers.

Библиографические ссылки

  1. Davey, M. P., Norman, L., Sterk, P., Huete‐Ortega, M., Bunbury, F., Loh, B. K. W., ... & Smith, A. G. (2019). Snow algae communities in Antarctica–metabolic and taxonomic composition. New Phytologist.

Дополнительные метаданные

Альтернативные идентификаторы http://ipt.biodiversity.aq/resource?r=antarctic_snow_algae_communities