Antarctic snow algae communities

Versões

A tabela abaixo mostra apenas versões de recursos que são publicamente acessíveis.

Como citar

Pesquisadores deveriam citar esta obra da seguinte maneira:

Davey M, Norman L, Sterk P, Huete-Ortega M, BunBury F, Kin Wai Loh B, Peck L, Conevy P, Newsham K, Smith A (2019): Antarctic snow algae communities. v1.1. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=antarctic_snow_algae_communities&v=1.1

Direitos

Pesquisadores devem respeitar a seguinte declaração de direitos:

O editor e o detentor dos direitos deste trabalho é SCAR - Microbial Antarctic Resource System. This work is licensed under a Creative Commons Attribution (CC-BY 4.0) License.

GBIF Registration

Este recurso foi registrado no GBIF e atribuído ao seguinte GBIF UUID: 3e77139d-6fbc-4e4e-86f0-ca966d398874.  SCAR - Microbial Antarctic Resource System publica este recurso, e está registrado no GBIF como um publicador de dados aprovado por Scientific Committee on Antarctic Research.

Palavras-chave

Metadata

Contatos

Cobertura Geográfica

Rothera Point, Anchorage Island, Léonie Island and Lagoon Island: Ryder Bay: Antarctic Peninsula

Cobertura Taxonômica

Bacteria (16S ssu rRNA marker gene)

Eukaryotes (18S ssu rRNA- ITS marker)

Cobertura Temporal

Dados Sobre o Projeto

Nenhuma descrição disponível

O pessoal envolvido no projeto:

Métodos de Amostragem

Snow samples were (1-5cm depth) taken in 6 x 50 ml sterile plastic sample tubes. The algae were collected by filling a sterile 50 ml tube with snow, which was not compacted.

Descrição dos passos do método:

1. Samples were returned within 3 h of sampling to the Bonner Laboratory (Rothera Research Station, Ryder Bay, Antarctica), where they were melted in 4 °C lit incubators (Sanyo). 10 ml of snow melt was pelleted using centrifugation (2000 g for 10 min, 4 °C), after which the supernatant was discarded and the remaining algal pellet was flash frozen in liquid nitrogen and stored at -80 °C.
2. Frozen pellets (approximately 1cm3) of field-collected algal communities from 10 ml snow melt were allowed to thaw before being resuspended in 1 ml of RNase-free water. After transferring to a clean 1.5 ml microfuge tube, the samples were ground with sterilised sand before adding another 1 ml of RNase-free water and subsequent transfer to a 15 ml capacity tube to which 3 ml of SDS-EB buffer (2% SDS, 400 mM NaCl, 40 mM EDTA, 100 mM Tris-HCl, pH8.0) were added, followed by mixing by vortexing and shaking for 5 min at 4 °C. Subsequently, 3 ml of chloroform were added, mixed gently by inversion and the whole suspension was centrifuged for 5 min at 2000 g and 4 °C, resulting in a two phase separation. The top aqueous phase was transferred to a new 15 ml capacity tube and two volumes of 100% chilled ethanol were added before incubating overnight at -20 °C.
3. The following day, the mix was spun at 6800 g at 0 °C for 30 min. After carefully discharging the supernatant, the pellet was resuspended with 1 ml of ethanol (70%) and recovered in a clean microfuge tube before determining total RNA concentration and quality. Libraries of the fourth hypervariable (V4) domain of 16S rRNA gene and internal transcribed spacer region (ITS) of rRNA gene were produced using the NEXTflexTM “16S V4” and “18S ITS” Amplicon-Seq Library Prep Kit and primers (BIOO Scientific, Austin, TX), respectively. For consistency we hereafter use the term “ITS” for the NEXTflex 18S-ITS region. The microbial 16S rRNA gene forward primer (V4 Forward) sequence was: 5’- GACGCTCTTCCGATCTTATGGTAATTGTGTGCCAGCMGCCGCGGTAA-3’ and the reverse primer (V4 Reverse) sequence was: 5’- TGTGCTCTTCCGATCTAGTCAGTCAGCCGGACTACHVGGGTWTCTAAT-3’. The This article is protected by copyright. All rights reserved. eukaryotic ITS forward primer (18S ITS Forward) sequence CTCTTTCCCTACACGACGCTCTTCCGATCTTCCGTAGGTGAACCTGCGG-3’ reverse primer (18S ITS Forward) CTGGAGTTCAGACGTGTGCTCTTCCGATCTTCCTCCGCTTATTGATATGC-3’. Samples were sequenced by Cambridge Genomic Services (Cambridge, UK) using an Illumina MiSeq v3 600-Cycle Sequencer following the manufacturer’s protocol and primers.

Citações bibliográficas

1. Davey, M. P., Norman, L., Sterk, P., Huete‐Ortega, M., Bunbury, F., Loh, B. K. W., ... & Smith, A. G. (2019). Snow algae communities in Antarctica–metabolic and taxonomic composition. New Phytologist.

Metadados Adicionais