- La version que vous regardez n'est pas la dernière version! Veuillez consulter le tableau des versions pour trouver la plus récente.
Bacteria (16S) in Antarctic terrestrial soils of the Sop Ronda mountains
Version 1.1 Publié par SCAR - Microbial Antarctic Resource System le Nov 19, 2018
Illumina sequencing data of bacterial communities in 52 soil samples from the western Sør Rondane Mountains (Dronning Maud Land, East Antarctica).The samples were taken along broad environmental gradients, including different types of bedrock, in an area covering nearly 1000 km2.
Téléchargements
Téléchargez la dernière version de la ressource "Métadonnées uniquement" au format EML ou RTF :
| Métadonnées sous forme de fichier EML | télécharger dans Anglais (10 KB) |
|---|---|
| Métadonnées sous forme de fichier RTF | télécharger dans Anglais (8 KB) |
Versions
Le tableau ci-dessous n'affiche que les versions publiées de la ressource accessibles publiquement.
Comment citer
Veuillez noter qu'il s'agit d'une ancienne version du jeu de données. Les chercheurs doivent citer cette ressource comme suit:
Verleyen E, Vyverman W, Willems A (2018): Bacteria (16S) in Antarctic terrestrial soils of the Sop Ronda mountains. v1.1. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. http://ipt.biodiversity.aq/resource?r=bacteria_antarctic_terrestrial_soils&v=1.1
Droits
Les chercheurs doivent respecter la déclaration de droits suivante:
L’éditeur et détenteur des droits de cette ressource est SCAR - Microbial Antarctic Resource System. This work is licensed under a Creative Commons Attribution (CC-BY) 4.0 License.
Enregistrement GBIF
Cette ressource a été enregistrée sur le portail GBIF, et possède l'UUID GBIF suivante : fcef9fcc-f737-46a1-b44e-edde5c5789a2. SCAR - Microbial Antarctic Resource System publie cette ressource, et est enregistré dans le GBIF comme éditeur de données avec l'approbation du Scientific Committee on Antarctic Research.
Mots-clé
Metadata
Contacts
Personne ayant créé cette ressource:
Personne pouvant répondre aux questions sur la ressource:
Personne ayant renseigné les métadonnées:
Autres personnes associées à la ressource:
Couverture géographique
Sor Ronda Mountains, East Antarctica
| Enveloppe géographique | Sud Ouest [-72.1, 22.7], Nord Est [-71.8, 24.6] |
|---|
Couverture taxonomique
16S ssh rRNA gene of Bacteria, using the primers pA (AGAGTTTGATCCTGGCTCAG, positions 8–27) and BKL1 (GTATTACCGCGGCTGCTGGCA, positions 536–516)
| Domain | Bacteria (bacteria) |
|---|
Couverture temporelle
| Date de début / Date de fin | 2009-01-01 / 2010-01-01 |
|---|
Données sur le projet
Pas de description disponible
| Titre | BELDIVA-AMBIO |
|---|---|
| Financement | This research was funded by the Special Research Fund BOF of (grant ) and by the Belgian Science Policy Office (BelSPO) projects BELDIVA (EA/00/05), AMBIO (SD/BA/01A) and CCAMBIO (SD/BA/03A). A. Wilmotte is Research Associate of the FRS-FNRS. This study is a contribution to the State of the Antarctic Ecosystem (AntEco) research program of the Scientific Committee on Antarctic Research (SCAR). |
| Description du domaine d'étude / de recherche | The Sop Ronda Mountains (SRM) (22° E-28° E, 71°30′ S-72°40′ S) are a 220 km long, east-west oriented mountain range, situated about 200 km inland, with peaks reaching 3300 m a.s.l. The bedrock is mainly metamorphic (e.g. gneiss) with some plutonic (granite) outcrops. |
Les personnes impliquées dans le projet:
Citations bibliographiques
- Tytgat, B., Verleyen, E., Sweetlove, M., D'hondt, S., Clercx, P., Van Ranst, E., ... & Vyverman, W. (2016). Bacterial community composition in relation to bedrock type and macrobiota in soils from the Sør Rondane Mountains, East Antarctica. FEMS microbiology ecology, 92(9).
Métadonnées additionnelles
| Identifiants alternatifs | http://ipt.biodiversity.aq/resource?r=bacteria_antarctic_terrestrial_soils |
|---|