• La version que vous regardez n'est pas la dernière version! Veuillez consulter le tableau des versions pour trouver la plus récente.

Bacteria (16S) in Antarctic terrestrial soils of the Sop Ronda mountains

Version 1.1 Publié par SCAR - Microbial Antarctic Resource System le Nov 19, 2018 SCAR - Microbial Antarctic Resource System

Illumina sequencing data of bacterial communities in 52 soil samples from the western Sør Rondane Mountains (Dronning Maud Land, East Antarctica).The samples were taken along broad environmental gradients, including different types of bedrock, in an area covering nearly 1000 km2.

Téléchargements

Téléchargez la dernière version de la ressource "Métadonnées uniquement" au format EML ou RTF :

Métadonnées sous forme de fichier EML télécharger dans Anglais (10 KB)
Métadonnées sous forme de fichier RTF télécharger dans Anglais (8 KB)

Versions

Le tableau ci-dessous n'affiche que les versions publiées de la ressource accessibles publiquement.

Comment citer

Veuillez noter qu'il s'agit d'une ancienne version du jeu de données.  Les chercheurs doivent citer cette ressource comme suit:

Verleyen E, Vyverman W, Willems A (2018): Bacteria (16S) in Antarctic terrestrial soils of the Sop Ronda mountains. v1.1. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. http://ipt.biodiversity.aq/resource?r=bacteria_antarctic_terrestrial_soils&v=1.1

Droits

Les chercheurs doivent respecter la déclaration de droits suivante:

L’éditeur et détenteur des droits de cette ressource est SCAR - Microbial Antarctic Resource System. This work is licensed under a Creative Commons Attribution (CC-BY) 4.0 License.

Enregistrement GBIF

Cette ressource a été enregistrée sur le portail GBIF, et possède l'UUID GBIF suivante : fcef9fcc-f737-46a1-b44e-edde5c5789a2.  SCAR - Microbial Antarctic Resource System publie cette ressource, et est enregistré dans le GBIF comme éditeur de données avec l'approbation du Scientific Committee on Antarctic Research.

Mots-clé

Metadata

Contacts

Personne ayant créé cette ressource:

Elie Verleyen
Professor
Ghent University Krijgslaan 281 9000 Ghent BE
Wim Vyverman
Professor
Ghent University Krijgslaan 281 9000 Ghent BE
Anne Willems
Professor
Ghent University 9000 Ghent BE

Personne pouvant répondre aux questions sur la ressource:

Bjorn Tytgat
Post doctoral assistent
Ghent University Krijgslaan 281 9000 Ghent BE

Personne ayant renseigné les métadonnées:

Maxime Sweetlove
assistent researcher
Royal Belgian Institute for Natural Sciences Rue Vautier 29 1000 Brussels BE

Autres personnes associées à la ressource:

Fournisseur de Contenu
Bjorn Tytgat
Post doctoral assistent
Ghent University Krijgslaan 281 9000 Ghent BE
Fournisseur de Contenu
Elie Verleyen
Professor
Ghent University Krijgslaan 281 9000 Ghent BE
Fournisseur de Contenu
Wim Vyverman
Professor
Ghent University Krijgslaan 281 9000 Ghent BE
Chercheur Principal
Anne Willems
Professor
Ghent University BE
Fournisseur de Contenu
Karolien Peeters
Post doctoral researcher
Ghent University BE
Zorigto Namsaraev
Post doctoral researcher
Kurchatov Institute

Couverture géographique

Sor Ronda Mountains, East Antarctica

Enveloppe géographique Sud Ouest [-72.1, 22.7], Nord Est [-71.8, 24.6]

Couverture taxonomique

16S ssh rRNA gene of Bacteria, using the primers pA (AGAGTTTGATCCTGGCTCAG, positions 8–27) and BKL1 (GTATTACCGCGGCTGCTGGCA, positions 536–516)

Domain  Bacteria (bacteria)

Couverture temporelle

Date de début / Date de fin 2009-01-01 / 2010-01-01

Données sur le projet

Pas de description disponible

Titre BELDIVA-AMBIO
Financement This research was funded by the Special Research Fund BOF of (grant ) and by the Belgian Science Policy Office (BelSPO) projects BELDIVA (EA/00/05), AMBIO (SD/BA/01A) and CCAMBIO (SD/BA/03A). A. Wilmotte is Research Associate of the FRS-FNRS. This study is a contribution to the State of the Antarctic Ecosystem (AntEco) research program of the Scientific Committee on Antarctic Research (SCAR).
Description du domaine d'étude / de recherche The Sop Ronda Mountains (SRM) (22° E-28° E, 71°30′ S-72°40′ S) are a 220 km long, east-west oriented mountain range, situated about 200 km inland, with peaks reaching 3300 m a.s.l. The bedrock is mainly metamorphic (e.g. gneiss) with some plutonic (granite) outcrops.

Les personnes impliquées dans le projet:

Bjorn Tytgat

Citations bibliographiques

  1. Tytgat, B., Verleyen, E., Sweetlove, M., D'hondt, S., Clercx, P., Van Ranst, E., ... & Vyverman, W. (2016). Bacterial community composition in relation to bedrock type and macrobiota in soils from the Sør Rondane Mountains, East Antarctica. FEMS microbiology ecology, 92(9).

Métadonnées additionnelles

Identifiants alternatifs http://ipt.biodiversity.aq/resource?r=bacteria_antarctic_terrestrial_soils