Descripción
Illumina sequencing data of bacterial communities in 52 soil samples from the western Sør Rondane Mountains (Dronning Maud Land, East Antarctica).The samples were taken along broad environmental gradients, including different types of bedrock, in an area covering nearly 1000 km2.
Versiones
La siguiente tabla muestra sólo las versiones publicadas del recurso que son de acceso público.
¿Cómo referenciar?
Los usuarios deben citar este trabajo de la siguiente manera:
Tytgat B, Vyverman W, Willems A, Verleyen E (2018): Bacteria (16S) in Antarctic terrestrial soils of the Sor Rondane Mountains. v1.4. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_terrestrial_soils&v=1.4
Derechos
Los usuarios deben respetar los siguientes derechos de uso:
El publicador y propietario de los derechos de este trabajo es SCAR - Microbial Antarctic Resource System. Esta obra está bajo una licencia Creative Commons de Atribución/Reconocimiento (CC-BY 4.0).
Registro GBIF
Este recurso ha sido registrado en GBIF con el siguiente UUID: fcef9fcc-f737-46a1-b44e-edde5c5789a2. SCAR - Microbial Antarctic Resource System publica este recurso y está registrado en GBIF como un publicador de datos avalado por Scientific Committee on Antarctic Research.
Palabras clave
Metadata
Contactos
- Proveedor De Contenido ●
- Originador ●
- Punto De Contacto
- Proveedor De Contenido ●
- Originador
- Proveedor De Contenido ●
- Originador
- Proveedor De Los Metadatos
- Proveedor De Contenido
Cobertura geográfica
Sor Ronda Mountains, East Antarctica
Coordenadas límite | Latitud Mínima Longitud Mínima [-72,1, 22,7], Latitud Máxima Longitud Máxima [-71,8, 24,6] |
---|
Cobertura taxonómica
16S ssh rRNA gene of Bacteria, using the primers pA (AGAGTTTGATCCTGGCTCAG, positions 8–27) and BKL1 (GTATTACCGCGGCTGCTGGCA, positions 536–516)
Dominio | Bacteria (bacteria) |
---|
Cobertura temporal
Fecha Inicial / Fecha Final | 2009-01-01 / 2010-01-01 |
---|
Datos del proyecto
No hay descripción disponible
Título | BELDIVA-AMBIO |
---|---|
Fuentes de Financiación | This research was funded by the Special Research Fund BOF of (grant ) and by the Belgian Science Policy Office (BelSPO) projects BELDIVA (EA/00/05), AMBIO (SD/BA/01A) and CCAMBIO (SD/BA/03A). A. Wilmotte is Research Associate of the FRS-FNRS. This study is a contribution to the State of the Antarctic Ecosystem (AntEco) research program of the Scientific Committee on Antarctic Research (SCAR). |
Descripción del área de estudio | The Sop Ronda Mountains (SRM) (22° E-28° E, 71°30′ S-72°40′ S) are a 220 km long, east-west oriented mountain range, situated about 200 km inland, with peaks reaching 3300 m a.s.l. The bedrock is mainly metamorphic (e.g. gneiss) with some plutonic (granite) outcrops. |
Personas asociadas al proyecto:
Referencias bibliográficas
- Tytgat, B., Verleyen, E., Sweetlove, M., D'hondt, S., Clercx, P., Van Ranst, E., ... & Vyverman, W. (2016). Bacterial community composition in relation to bedrock type and macrobiota in soils from the Sør Rondane Mountains, East Antarctica. FEMS microbiology ecology, 92(9).
Metadatos adicionales
Identificadores alternativos | fcef9fcc-f737-46a1-b44e-edde5c5789a2 |
---|---|
https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_terrestrial_soils |