Bacteria (16S) in Antarctic terrestrial soils of the Sor Rondane Mountains

Последняя версия опубликована SCAR - Microbial Antarctic Resource System Mar 19, 2019 SCAR - Microbial Antarctic Resource System

Illumina sequencing data of bacterial communities in 52 soil samples from the western Sør Rondane Mountains (Dronning Maud Land, East Antarctica).The samples were taken along broad environmental gradients, including different types of bedrock, in an area covering nearly 1000 km2.

Загрузки

Скачайте последнюю версию метаданных ресурса (только метаданные) в формате EML или RTF:

Метаданные в формате EML Скачать в English (11 KB)
Метаданные в формате RTF Скачать в English (8 KB)

Версии

В таблице ниже указаны только опубликованные версии ресурса, которые доступны для свободного скачивания.

Как оформить ссылку

Исследователи должны дать ссылку на эту работу следующим образом:

Tytgat B, Vyverman W, Willems A, Verleyen E (2018): Bacteria (16S) in Antarctic terrestrial soils of the Sor Rondane Mountains. v1.4. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_terrestrial_soils&v=1.4

Права

Исследователи должны соблюдать следующие права:

Публикующей организацией и владельцем прав на данную работу является SCAR - Microbial Antarctic Resource System. This work is licensed under a Creative Commons Attribution (CC-BY) 4.0 License.

Регистрация в GBIF

Этот ресурс был зарегистрирован в GBIF, ему был присвоен следующий UUID: fcef9fcc-f737-46a1-b44e-edde5c5789a2.  SCAR - Microbial Antarctic Resource System отвечает за публикацию этого ресурса, и зарегистрирован в GBIF как издатель данных при оподдержке Scientific Committee on Antarctic Research.

Ключевые слова

Metadata

Контакты

Кто является создателем ресурса:

Bjorn Tytgat
Post doctoral assistent
Ghent University Krijgslaan 281 9000 Ghent BE
Wim Vyverman
Professor
Ghent University Krijgslaan 281 9000 Ghent BE
Anne Willems
Professor
Ghent University 9000 Ghent BE
Elie Verleyen
Professor
Ghent University Krijgslaan 281 9000 Ghent BE

Кто может ответить на вопросы о ресурсе:

Bjorn Tytgat
Post doctoral assistent
Ghent University Krijgslaan 281 9000 Ghent BE

Кем заполнены метаданные:

Maxime Sweetlove
assistent researcher
Royal Belgian Institute for Natural Sciences Rue Vautier 29 1000 Brussels BE

Кто еще связан с данным ресурсом:

Content Provider
Bjorn Tytgat
Post doctoral assistent
Ghent University Krijgslaan 281 9000 Ghent BE
Content Provider
Elie Verleyen
Professor
Ghent University Krijgslaan 281 9000 Ghent BE
Content Provider
Wim Vyverman
Professor
Ghent University Krijgslaan 281 9000 Ghent BE
Principal Investigator
Anne Willems
Professor
Ghent University BE
Content Provider
Karolien Peeters
Post doctoral researcher
Ghent University BE
Zorigto Namsaraev
Post doctoral researcher
Kurchatov Institute

Географический охват

Sor Ronda Mountains, East Antarctica

Ограничивающие координаты Юг Запад [-72.1, 22.7], Север Восток [-71.8, 24.6]

Таксономический охват

16S ssh rRNA gene of Bacteria, using the primers pA (AGAGTTTGATCCTGGCTCAG, positions 8–27) and BKL1 (GTATTACCGCGGCTGCTGGCA, positions 536–516)

Domain  Bacteria (bacteria)

Временной охват

Дата начала / Дата окончания 2009-01-01 / 2010-01-01

Данные проекта

Описание отсутсвует

Название BELDIVA-AMBIO
Финансирование This research was funded by the Special Research Fund BOF of (grant ) and by the Belgian Science Policy Office (BelSPO) projects BELDIVA (EA/00/05), AMBIO (SD/BA/01A) and CCAMBIO (SD/BA/03A). A. Wilmotte is Research Associate of the FRS-FNRS. This study is a contribution to the State of the Antarctic Ecosystem (AntEco) research program of the Scientific Committee on Antarctic Research (SCAR).
Описание района исследования The Sop Ronda Mountains (SRM) (22° E-28° E, 71°30′ S-72°40′ S) are a 220 km long, east-west oriented mountain range, situated about 200 km inland, with peaks reaching 3300 m a.s.l. The bedrock is mainly metamorphic (e.g. gneiss) with some plutonic (granite) outcrops.

Исполнители проекта:

Bjorn Tytgat

Библиографические ссылки

  1. Tytgat, B., Verleyen, E., Sweetlove, M., D'hondt, S., Clercx, P., Van Ranst, E., ... & Vyverman, W. (2016). Bacterial community composition in relation to bedrock type and macrobiota in soils from the Sør Rondane Mountains, East Antarctica. FEMS microbiology ecology, 92(9).

Дополнительные метаданные

Альтернативные идентификаторы fcef9fcc-f737-46a1-b44e-edde5c5789a2
https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_terrestrial_soils