- Версия, с которой Вы работаете не является последней! Пожалуйста, обратитесь к таблице версий, чтобы найти последнюю версию.
Microbial soil Fungi (ITS2) diversity from Maritime Antarctica
Версия 1.1 опубликована SCAR - Microbial Antarctic Resource System Jan 17, 2019
Amplicon sequencing dataset (454) of microbial fungi (ITS2 marker gene) in soils from the Antarctic Peninsula and Maritime Antarctic Islands.
Версии
В таблице ниже указаны только опубликованные версии ресурса, которые доступны для свободного скачивания.
Как оформить ссылку
Пожалуйста, имейте в виду, это старая версия набора данных. Исследователи должны дать ссылку на эту работу следующим образом:
Newsham K, Hopkins D, Carvalhais L, Fretwell P, Rushton S, O'Donnell A, Dennis P (2019): Microbial soil Fungi (ITS2) diversity from Maritime Antarctica. v1.1. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. http://ipt.biodiversity.aq/resource?r=soil_fungi_its2_maritime_antarctica&v=1.1
Права
Исследователи должны соблюдать следующие права:
Публикующей организацией и владельцем прав на данную работу является SCAR - Microbial Antarctic Resource System. This work is licensed under a Creative Commons Attribution (CC-BY) 4.0 License.
Регистрация в GBIF
Этот ресурс был зарегистрирован в GBIF, ему был присвоен следующий UUID: 7c5815a5-7909-418b-87dc-af0cab0e57ce. SCAR - Microbial Antarctic Resource System отвечает за публикацию этого ресурса, и зарегистрирован в GBIF как издатель данных при оподдержке Scientific Committee on Antarctic Research.
Ключевые слова
Metadata
Контакты
Кто является создателем ресурса:
Кто может ответить на вопросы о ресурсе:
Кем заполнены метаданные:
Кто еще связан с данным ресурсом:
Географический охват
Soil samples from the Antarctic Peninsula and Maritime Antarctic Islands.
| Ограничивающие координаты | Юг Запад [-71.878, -71.844], Север Восток [-60.701, -45.661] |
|---|
Таксономический охват
microbial soil Fungi, ITS2 marker gene
| Phylum | Fungi (Fungi) |
|---|
Данные проекта
Описание отсутсвует
| Название | Microbial soil Fungi (ITS2) diversity from Maritime Antarctica |
|---|---|
| Финансирование | This work was funded by a UK Natural Environment Research Council Antarctic Funding Initiative grant (NE/D00893X/1; AFI 7/05) and a University of Queensland Early Career Researcher Award. |
Исполнители проекта:
Методы сбора
The uppermost five centimetres of soil was collected in 50 ml DNA/RNAase-treated plastic tubes (30 mm diam.) from each of five locations at each site and was bulked. The soil was then immediately snap-frozen by immersion in a mixture of dry ice and ethanol (c. -80 °C). Samples were maintained at -80 °C from the time of sampling until they were processed.
| Охват исследования | Soils without plant cover were sampled along the climatic gradient in Maritime Antarctica. |
|---|
Описание этапа методики:
- Total DNA was extracted under sterile conditions from 10 g of soil using a PowerMax® Soil DNA isolation kit (MO BIO Laboratories, Inc., Carlsbad, CA, USA) as per the manufacturer’s instructions. The internal transcribed spacer 2 (ITS2) region of the ribosomal RNA encoding genes was amplified by polymerase chain reaction (PCR) using the primers gITS7 (5′ GTGARTCATCGARTCTTTG27) and ITS4 (5′ TCCTCCGCTTATTGATATGC28), which target sites in the 5.8S gene and ribosomal large subunit, respectively. The gITS7 primer was 5’-labelled with the 454 FLX sequencing primer adapter B sequence and the ITS4 primer was 5’-labelled with a sample specific barcode sequence and the 454 FLX sequencing primer adapter A sequence. PCRs were performed in duplicate 50 μl reactions, each containing 5 ng template DNA, 1X Phusion® High Fidelity PCR Buffer (New England Biolabs Inc.), 0.2 mM of each of the dNTPs (Invitrogen), 0.3 μM of the ITS4 primer, 0.5 μM of the gITS7 primer, and 1U of 1X Phusion® High Fidelity DNA Polymerase (New England Biolabs Inc.). Thermocycling conditions were as follows: 98 °C for 30 s, 35 cycles of 98 °C for 10 s, 56 °C for 30 s, 72 °C for 15 s and a final extension at 72 °C for 7 min. Negative controls, consisting of sterile water in place of template DNA, did not yield amplicons. Amplicons were purified using a Wizard® SV Gel and PCR Clean-Up System (Promega), quantified with a Qubit fluorometer with a Quant-iT dsDNA HF assay kit and then 72 ng of each sample was pooled. The pooled sample was purified again using a QIAquick PCR Purification Kit (Qiagen), and then sent to Macrogen (Seoul, Korea) for 454 pyrosequencing.
Библиографические ссылки
- Newsham, K. K., Hopkins, D. W., Carvalhais, L. C., Fretwell, P. T., Rushton, S. P., O’Donnell, A. G., & Dennis, P. G. (2016). Relationship between soil fungal diversity and temperature in the maritime Antarctic. Nature Climate Change, 6(2), 182.
Дополнительные метаданные
| Альтернативные идентификаторы | 7c5815a5-7909-418b-87dc-af0cab0e57ce |
|---|---|
| http://ipt.biodiversity.aq/resource?r=soil_fungi_its2_maritime_antarctica |