Associated microbiome (Bacteria and Fungi) in Antarctic sea stars (healthy versus exhibiting epidermal disease)

Version 1.0 Publié par SCAR - Microbial Antarctic Resource System le déc. 18, 2018 SCAR - Microbial Antarctic Resource System
Date de publication:
18 décembre 2018
Licence:
CC-BY 4.0

Téléchargez la dernière version de la ressource "Métadonnées uniquement" au format EML ou RTF :

Métadonnées sous forme de fichier EML télécharger dans Anglais (11 KB)
Métadonnées sous forme de fichier RTF télécharger dans Anglais (13 KB)

Description

Amplicon sequencing dataset (Illumina MiSeq) of bacteria (16S ssu rRNA gene) and Fungi (ITS) associated with healthy and diseased Antarctic sea stars (Odontaster validus)

Versions

Le tableau ci-dessous n'affiche que les versions publiées de la ressource accessibles publiquement.

Comment citer

Veuillez noter qu'il s'agit d'une ancienne version du jeu de données.  Les chercheurs doivent citer cette ressource comme suit:

Núñez-Pons L, Work T, Angulo-Preckler C, Moles J, Avila C (2018): Associated microbiome (Bacteria and Fungi) in Antarctic sea stars (healthy versus exhibiting epidermal disease). v1.0. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. http://ipt.biodiversity.aq/resource?r=associated_microbiome_antarctic_sea_stars&v=1.0

Droits

Les chercheurs doivent respecter la déclaration de droits suivante:

L’éditeur et détenteur des droits de cette ressource est SCAR - Microbial Antarctic Resource System. Ce travail est sous licence Creative Commons Attribution (CC-BY) 4.0.

Enregistrement GBIF

Cette ressource a été enregistrée sur le portail GBIF, et possède l'UUID GBIF suivante : 5400a04a-01ba-46d3-8470-d256219e6a6a.  SCAR - Microbial Antarctic Resource System publie cette ressource, et est enregistré dans le GBIF comme éditeur de données avec l'approbation du Scientific Committee on Antarctic Research.

Mots-clé

Metadata

Contacts

Laura Núñez-Pons
  • Créateur
  • Personne De Contact
Research fellow
Stazione Zoologica Anton Dohrn
Napoli
Thierry Work
  • Créateur
Researcher
US Geological Survey
Honolulu
US
Carlos Angulo-Preckler
  • Créateur
Post doctoral fellow
University of Barcelona
Barcelona
ES
Juan Moles
  • Créateur
Post doctoral fellow
Museum of Comparative Zoology & Department of Organismic and Evolutionary Biology
Cambridge
GB
Conxita Avila
  • Créateur
Professor
University of Barcelona
Barcelona
ES
Maxime Sweetlove
  • Fournisseur Des Métadonnées
Research assistent
Royal Belgian Institute for Natural Sciences
Rue Vautier 29
1000 Brussels

Couverture géographique

Deception island, Antarctica

Enveloppe géographique Sud Ouest [-62,95, -60,64], Nord Est [-62,95, -60,64]

Couverture taxonomique

microbiome (bacteria (16S ssu rRNA gene) and Fungi (ITS)) associated with Antarctic sea stars (Odontaster validus)

Domain Bacteria (Bacteria)
Kingdom Fungi (Fungi)
Species Odontaster validus (sea star)

Couverture temporelle

Epoque de formation 2013-2016

Données sur le projet

Pas de description disponible

Titre ACTIQUIM and DISTANTCOM
Financement Project funding was obtained from the Spanish government through the ACTIQUIM and DISTANTCOM Projects (CGL2004-03356/ANT, CGL2007-65453/ANT, and CTM2010-17415/ANT; CTM2013-42667/ANT). additional support was provided by the Fundación Ramón Areces and Beatriu de Pinós Marie Curie CO-Fund Program (Catalonia).

Les personnes impliquées dans le projet:

Laura Núñez-Pons

Méthodes d'échantillonnage

Twenty-five healthy and diseased O validus (n = 50) were collected by SCUBA diving on February 2013. Tissue biopsies (1 cm3) were removed with sterile scalpel from 30 individuals (15 healthy and 15 diseased) as follows: 15 sections from healthy specimens, 15 affected lesion fronts from diseased sea stars, and 15 tissue areas several cm away from the lesions of the same diseased specimens. Samples were divided in two subsamples, one preserved in 100% ethanol at −20 °C for DNA extraction and microbial characterization, and the other fixed in 2.5% paraformaldehyde in filtered sea water at 4 °C for histopathology studies.

Etendue de l'étude Transect surveys were conducted to assess the prevalence of epidermal lesions in sea stars around Port Foster’s bay (Deception Island) during the Antarctic expedition ACTIQUIM-4 (January–February 2013). Five haphazardly chosen replicate 50-m linear transects were surveyed at 5 m and 15 m depth at eight sites around the bay (80 transects in total). Apparently healthy O. validus and specimens with lesions were recorded within 2 m of each transect line. The census was repeated in 2016.

Description des étapes de la méthode:

  1. DNA from healthy and lesioned tissues of healthy and diseased stars were extracted using a modified C-TAB organic extraction protocol for amplicon deep sequencing of ribosomal gene target markers on MiSeq (Illumina), for bacterial/archaeal and fungal community composition, which were performed with a two-PCR protocol and two dual-index strategy. In the first PCR, we used bacterial specific primers to amplify the V3–V4 region of the small-subunit ribosomal RNA (16S) gene (341 F and 785 R); and fungi-specific primers ITS1F41 and ITS2R targeting the internal transcribed spacer 1 (ITS1) region of fungi. Amplifications were performed in 25 µl reactions with NEBNext® Q5® Hot Start HiFi PCR Master Mix (New England Biolabs, Inc.), 0.8 µl BSA (Bovine Serum Albumin; 20 mg/ml), 1 µl of each 5 µM primer, and 1.5 µl of template. Reactions were under the thermocycling profile: 98 °C for 2 min, then 28 cycles of 98 °C for 15 s, 53 °C for 30 s, 72 °C for 30 s, final extension at 72 °C for 2 min. The second Index PCR to attach dual indexes and Illumina sequencing adapters used forward primers with the 5′-3′ Illumina i5 adapter (AATGATACGGCGACCACCGAGATCTACAC), an 8–10 bp barcode and a primer pad; and reverse fusion primers with 5′-3′ Illumina i7 adapter (CAAGCAGAAGACGGCATACGAGAT), an 8–10 bp barcode, a primer pad. Reactions were made in 25 μl with 0.5 µl of each 5 µM primer, and 1 µl of corresponding products from first amplicon PCR reactions diluted (1:30), and with a temperature regime of: 98 °C for 2 min, then 28 cycles of 98 °C for 15 s, 55 °C for 30 s, 72 °C for 30 s, final extension at 72 °C for 2 min. The PCR products were purified and pooled equimolar on Just-a-Plate™ 96 PCR Purification and Normalization Kit plates following manufacturer’s instructions (Charm Biotec).
  2. Paired-end sequencing was performed on an Illumina MiSeq sequencer 2 × 300 flow cell at 10 pM at Core Lab, Hawai’i Institute of Marine Biology (Hawai’i, USA).

Citations bibliographiques

  1. Núñez-Pons, L., Work, T. M., Angulo-Preckler, C., Moles, J., & Avila, C. (2018). Exploring the pathology of an epidermal disease affecting a circum-Antarctic sea star. Scientific reports, 8(1), 11353.

Métadonnées additionnelles