Associated microbiome (Bacteria and Fungi) in Antarctic sea stars (healthy versus exhibiting epidermal disease)
Latest version published by SCAR - Microbial Antarctic Resource System on 19 March 2019 SCAR - Microbial Antarctic Resource System

Amplicon sequencing dataset (Illumina MiSeq) of bacteria (16S ssu rRNA gene) and Fungi (ITS) associated with healthy and diseased Antarctic sea stars (Odontaster validus)

GBIF EML RTF Versions Rights Cite this

Download the latest version of the metadata-only resource metadata as EML or RTF:

Metadata as an EML file download in English (11 kB)
Metadata as an RTF file download in English (13 kB)

The table below shows only published versions of the resource that are publicly accessible.

How to cite

Researchers should cite this work as follows:

Núñez-Pons L, Work T, Angulo-Preckler C, Moles J, Avila C (2018): Associated microbiome (Bacteria and Fungi) in Antarctic sea stars (healthy versus exhibiting epidermal disease). v1.2. SCAR - Microbial Antarctic Resource System. Dataset/Metadata.


Researchers should respect the following rights statement:

The publisher and rights holder of this work is SCAR - Microbial Antarctic Resource System. This work is licensed under a Creative Commons Attribution (CC-BY) 4.0 License.

GBIF Registration

This resource has been registered with GBIF, and assigned the following GBIF UUID: 5400a04a-01ba-46d3-8470-d256219e6a6a.  SCAR - Microbial Antarctic Resource System publishes this resource, and is itself registered in GBIF as a data publisher endorsed by Scientific Committee on Antarctic Research.




Who created the resource:

Laura Núñez-Pons
Stazione Zoologica Anton Dohrn
Thierry Work
US Geological Survey
Carlos Angulo-Preckler
University of Barcelona
Juan Moles
Museum of Comparative Zoology & Department of Organismic and Evolutionary Biology
Conxita Avila
University of Barcelona

Who can answer questions about the resource:

Laura Núñez-Pons
Stazione Zoologica Anton Dohrn

Who filled in the metadata:

Maxime Sweetlove
Research assistent
Royal Belgian Institute for Natural Sciences
Rue Vautier 29
1000 Brussels

Who else was associated with the resource:

Geographic Coverage

Deception island, Antarctica

Bounding Coordinates South West [-62.95, -60.64], North East [-62.95, -60.64]
Taxonomic Coverage

microbiome (bacteria (16S ssu rRNA gene) and Fungi (ITS)) associated with Antarctic sea stars (Odontaster validus)

Domain  Bacteria (Bacteria)
Kingdom  Fungi (Fungi)
Species  Odontaster validus (sea star)
Temporal Coverage
Formation Period 2013-2016
Project Data

No Description available

Funding Project funding was obtained from the Spanish government through the ACTIQUIM and DISTANTCOM Projects (CGL2004-03356/ANT, CGL2007-65453/ANT, and CTM2010-17415/ANT; CTM2013-42667/ANT). additional support was provided by the Fundación Ramón Areces and Beatriu de Pinós Marie Curie CO-Fund Program (Catalonia).

The personnel involved in the project:

Laura Núñez-Pons
Sampling Methods

Twenty-five healthy and diseased O validus (n = 50) were collected by SCUBA diving on February 2013. Tissue biopsies (1 cm3) were removed with sterile scalpel from 30 individuals (15 healthy and 15 diseased) as follows: 15 sections from healthy specimens, 15 affected lesion fronts from diseased sea stars, and 15 tissue areas several cm away from the lesions of the same diseased specimens. Samples were divided in two subsamples, one preserved in 100% ethanol at −20 °C for DNA extraction and microbial characterization, and the other fixed in 2.5% paraformaldehyde in filtered sea water at 4 °C for histopathology studies.

Study Extent Transect surveys were conducted to assess the prevalence of epidermal lesions in sea stars around Port Foster’s bay (Deception Island) during the Antarctic expedition ACTIQUIM-4 (January–February 2013). Five haphazardly chosen replicate 50-m linear transects were surveyed at 5 m and 15 m depth at eight sites around the bay (80 transects in total). Apparently healthy O. validus and specimens with lesions were recorded within 2 m of each transect line. The census was repeated in 2016.

Method step description:

  1. DNA from healthy and lesioned tissues of healthy and diseased stars were extracted using a modified C-TAB organic extraction protocol for amplicon deep sequencing of ribosomal gene target markers on MiSeq (Illumina), for bacterial/archaeal and fungal community composition, which were performed with a two-PCR protocol and two dual-index strategy. In the first PCR, we used bacterial specific primers to amplify the V3–V4 region of the small-subunit ribosomal RNA (16S) gene (341 F and 785 R); and fungi-specific primers ITS1F41 and ITS2R targeting the internal transcribed spacer 1 (ITS1) region of fungi. Amplifications were performed in 25 µl reactions with NEBNext® Q5® Hot Start HiFi PCR Master Mix (New England Biolabs, Inc.), 0.8 µl BSA (Bovine Serum Albumin; 20 mg/ml), 1 µl of each 5 µM primer, and 1.5 µl of template. Reactions were under the thermocycling profile: 98 °C for 2 min, then 28 cycles of 98 °C for 15 s, 53 °C for 30 s, 72 °C for 30 s, final extension at 72 °C for 2 min. The second Index PCR to attach dual indexes and Illumina sequencing adapters used forward primers with the 5′-3′ Illumina i5 adapter (AATGATACGGCGACCACCGAGATCTACAC), an 8–10 bp barcode and a primer pad; and reverse fusion primers with 5′-3′ Illumina i7 adapter (CAAGCAGAAGACGGCATACGAGAT), an 8–10 bp barcode, a primer pad. Reactions were made in 25 μl with 0.5 µl of each 5 µM primer, and 1 µl of corresponding products from first amplicon PCR reactions diluted (1:30), and with a temperature regime of: 98 °C for 2 min, then 28 cycles of 98 °C for 15 s, 55 °C for 30 s, 72 °C for 30 s, final extension at 72 °C for 2 min. The PCR products were purified and pooled equimolar on Just-a-Plate™ 96 PCR Purification and Normalization Kit plates following manufacturer’s instructions (Charm Biotec).
  2. Paired-end sequencing was performed on an Illumina MiSeq sequencer 2 × 300 flow cell at 10 pM at Core Lab, Hawai’i Institute of Marine Biology (Hawai’i, USA).
Bibliographic Citations
  1. Núñez-Pons, L., Work, T. M., Angulo-Preckler, C., Moles, J., & Avila, C. (2018). Exploring the pathology of an epidermal disease affecting a circum-Antarctic sea star. Scientific reports, 8(1), 11353.
Additional Metadata
Alternative Identifiers 5400a04a-01ba-46d3-8470-d256219e6a6a