Descrição
Amplicon sequencing dataset (Illumina MiSeq) of Bacteria (16S ssu rRNA) in an Antarctic glacial foreland soil gradient
Versões
A tabela abaixo mostra apenas versões de recursos que são publicamente acessíveis.
Como citar
Lembre-se, esta é uma versão antiga do dataset. Pesquisadores deveriam citar esta obra da seguinte maneira:
Yan W, Ma H, Shi G, Sun B, Xiao X, Zhang Y (2018): Bacteria in Antarctic glacial foreland soils. v1.1. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. http://ipt.biodiversity.aq/resource?r=bacteria_antarctic_glacial_foreland_soils&v=1.1
Direitos
Pesquisadores devem respeitar a seguinte declaração de direitos:
O editor e o detentor dos direitos deste trabalho é SCAR - Microbial Antarctic Resource System. This work is licensed under a Creative Commons Attribution (CC-BY 4.0) License.
GBIF Registration
Este recurso foi registrado no GBIF e atribuído ao seguinte GBIF UUID: 8e7cf0b8-4789-4b79-9dc9-33d65ed79918. SCAR - Microbial Antarctic Resource System publica este recurso, e está registrado no GBIF como um publicador de dados aprovado por Scientific Committee on Antarctic Research.
Palavras-chave
Metadata
Contatos
- Originador ●
- Ponto De Contato
- Originador
- Originador
- Originador
- Originador
- Originador
- Provedor Dos Metadados
Cobertura Geográfica
Soil samples were collected from the glacial foreland in Larsemann Hills in East Antarctica
Coordenadas delimitadoras | Sul Oeste [-69, 76,407], Norte Leste [-69, 76,407] |
---|
Cobertura Taxonômica
Bacteria 16S ssu rRNA marker gene, v4 region
Domínio | Bacteria (Bacteria) |
---|
Dados Sobre o Projeto
Nenhuma descrição disponível
Título | Bacteria in Antarctic glacial foreland soils |
---|---|
Financiamento | Funding was provided by the National Natural Science Foundation of China (grants 41276202, 41476123, 41676177), China Ocean Mineral Resources R&D Association (grants DY125-22-04), and the thirteen Five-Year Plan for Polar Science (grants CHINARE 2016-02-02). |
O pessoal envolvido no projeto:
Métodos de Amostragem
Surface soil layers, approximately 5 cm, were collected. When sites were covered by ice (3,4 and 5), the covering ice was gently cracked and the ice fractures were removed before sampling the soil beneath. The samples were stored in plastic bags and kept at -20°C during transport and storage in the laboratory until they were used for further analysis.
Área de Estudo | Soil samples were collected from the glacial foreland in Larsemann Hills in East Antarctica (-69.39762S, 76.40666 E), during the 29th Chinese National Antarctic Research Expedition in the Antarctic summer in February 2013. |
---|
Descrição dos passos do método:
- Each soil sample was homogenized and sub-sampled for DNA extraction and geochemical measurements.
- An SDS-based method was employed to extract the DNA from soil (Natarajan et al., 2016). The bacterial V4 region of the 16S rRNA gene was amplified with a special bacterial primer pair 533F (TGCCAGCAGCCGCGGTAA)/Bact806R (GGACTACCAGGGTATCTAATCCTGTT). A sample tagging approach was employed, and a different barcode was added before the forward primer for each sample. The PCR reagents were mixed as follow: 5 μl of 10× Taq buffer (Takara, Otsu, Shiga, Japan), 4 μl of dNTP (Takara, Otsu, Shiga, Japan), 1 μl of each primer (10 μM stored concentration), 0.25 μl of Ex Taq DNA polymerase (Takara, Otsu, Shiga, Japan), approximately 50 ng of DNA, 2.5 μl of BSA (Bull Serum Albumin), and 32.75 μl of water. The PCR amplification consisted of an initial denaturation at 94°C for 5 min; 25 cycles of denaturation at 94°C for 40 s, annealing at 58°C for 40 s, and extension at 72°C for 1 min; and a final extension at 72°C for 8 min. The PCR products were purified with a Gel Extraction Kit (Omega Bio-Tek, Norcross, GA, United States) according to the manufacturer’s instructions.
- The reads were obtained with MiSeq sequencing platform (Illumina, San Diego, CA, United States).
Citações bibliográficas
- Yan, W., Ma, H., Shi, G., Li, Y., Sun, B., Xiao, X., & Zhang, Y. (2017). Independent Shifts of Abundant and Rare Bacterial Populations across East Antarctica Glacial Foreland. Frontiers in microbiology, 8, 1534.
Metadados Adicionais
Identificadores alternativos | http://ipt.biodiversity.aq/resource?r=bacteria_antarctic_glacial_foreland_soils |
---|