Description
Amplicon sequencing dataset (454) of microbial fungi (ITS2 marker gene) in soils from the Antarctic Peninsula and Maritime Antarctic Islands.
Versions
Le tableau ci-dessous n'affiche que les versions publiées de la ressource accessibles publiquement.
Comment citer
Les chercheurs doivent citer cette ressource comme suit:
Newsham K, Hopkins D, Carvalhais L, Fretwell P, Rushton S, O'Donnell A, Dennis P (2019): Microbial soil Fungi (ITS2) diversity from Maritime Antarctica. v1.2. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=soil_fungi_its2_maritime_antarctica&v=1.2
Droits
Les chercheurs doivent respecter la déclaration de droits suivante:
L’éditeur et détenteur des droits de cette ressource est SCAR - Microbial Antarctic Resource System. Ce travail est sous licence Creative Commons Attribution (CC-BY) 4.0.
Enregistrement GBIF
Cette ressource a été enregistrée sur le portail GBIF, et possède l'UUID GBIF suivante : 7c5815a5-7909-418b-87dc-af0cab0e57ce. SCAR - Microbial Antarctic Resource System publie cette ressource, et est enregistré dans le GBIF comme éditeur de données avec l'approbation du Scientific Committee on Antarctic Research.
Mots-clé
Metadata
Contacts
- Créateur ●
- Personne De Contact
- Créateur
- Créateur
- Créateur
- Créateur
- Créateur
- Créateur ●
- Personne De Contact
- Fournisseur Des Métadonnées
- Research assistent
- Rue Vautier 29
Couverture géographique
Soil samples from the Antarctic Peninsula and Maritime Antarctic Islands.
| Enveloppe géographique | Sud Ouest [-71,878, -71,844], Nord Est [-60,701, -45,661] |
|---|
Couverture taxonomique
microbial soil Fungi, ITS2 marker gene
| Phylum | Fungi (Fungi) |
|---|
Données sur le projet
Pas de description disponible
| Titre | Microbial soil Fungi (ITS2) diversity from Maritime Antarctica |
|---|---|
| Financement | This work was funded by a UK Natural Environment Research Council Antarctic Funding Initiative grant (NE/D00893X/1; AFI 7/05) and a University of Queensland Early Career Researcher Award. |
Les personnes impliquées dans le projet:
Méthodes d'échantillonnage
The uppermost five centimetres of soil was collected in 50 ml DNA/RNAase-treated plastic tubes (30 mm diam.) from each of five locations at each site and was bulked. The soil was then immediately snap-frozen by immersion in a mixture of dry ice and ethanol (c. -80 °C). Samples were maintained at -80 °C from the time of sampling until they were processed.
| Etendue de l'étude | Soils without plant cover were sampled along the climatic gradient in Maritime Antarctica. |
|---|
Description des étapes de la méthode:
- Total DNA was extracted under sterile conditions from 10 g of soil using a PowerMax® Soil DNA isolation kit (MO BIO Laboratories, Inc., Carlsbad, CA, USA) as per the manufacturer’s instructions. The internal transcribed spacer 2 (ITS2) region of the ribosomal RNA encoding genes was amplified by polymerase chain reaction (PCR) using the primers gITS7 (5′ GTGARTCATCGARTCTTTG27) and ITS4 (5′ TCCTCCGCTTATTGATATGC28), which target sites in the 5.8S gene and ribosomal large subunit, respectively. The gITS7 primer was 5’-labelled with the 454 FLX sequencing primer adapter B sequence and the ITS4 primer was 5’-labelled with a sample specific barcode sequence and the 454 FLX sequencing primer adapter A sequence. PCRs were performed in duplicate 50 μl reactions, each containing 5 ng template DNA, 1X Phusion® High Fidelity PCR Buffer (New England Biolabs Inc.), 0.2 mM of each of the dNTPs (Invitrogen), 0.3 μM of the ITS4 primer, 0.5 μM of the gITS7 primer, and 1U of 1X Phusion® High Fidelity DNA Polymerase (New England Biolabs Inc.). Thermocycling conditions were as follows: 98 °C for 30 s, 35 cycles of 98 °C for 10 s, 56 °C for 30 s, 72 °C for 15 s and a final extension at 72 °C for 7 min. Negative controls, consisting of sterile water in place of template DNA, did not yield amplicons. Amplicons were purified using a Wizard® SV Gel and PCR Clean-Up System (Promega), quantified with a Qubit fluorometer with a Quant-iT dsDNA HF assay kit and then 72 ng of each sample was pooled. The pooled sample was purified again using a QIAquick PCR Purification Kit (Qiagen), and then sent to Macrogen (Seoul, Korea) for 454 pyrosequencing.
Citations bibliographiques
- Newsham, K. K., Hopkins, D. W., Carvalhais, L. C., Fretwell, P. T., Rushton, S. P., O’Donnell, A. G., & Dennis, P. G. (2016). Relationship between soil fungal diversity and temperature in the maritime Antarctic. Nature Climate Change, 6(2), 182.
Métadonnées additionnelles
| Identifiants alternatifs | 7c5815a5-7909-418b-87dc-af0cab0e57ce |
|---|---|
| https://ipt.biodiversity.aq/resource?r=soil_fungi_its2_maritime_antarctica |