Microbial soil Fungi (ITS2) diversity from Maritime Antarctica
Последняя версия опубликована SCAR - Microbial Antarctic Resource System 19 марта 2019 г. SCAR - Microbial Antarctic Resource System

Amplicon sequencing dataset (454) of microbial fungi (ITS2 marker gene) in soils from the Antarctic Peninsula and Maritime Antarctic Islands.

GBIF EML RTF Версии Права Процитируйте это

Скачайте последнюю версию метаданных ресурса (только метаданные) в формате EML или RTF:

Метаданные в формате EML Скачать в English (10 kB)
Метаданные в формате RTF Скачать в English (10 kB)

В таблице ниже указаны только опубликованные версии ресурса, которые доступны для свободного скачивания.

Как оформить ссылку

Исследователи должны дать ссылку на эту работу следующим образом:

Newsham K, Hopkins D, Carvalhais L, Fretwell P, Rushton S, O'Donnell A, Dennis P (2019): Microbial soil Fungi (ITS2) diversity from Maritime Antarctica. v1.2. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=soil_fungi_its2_maritime_antarctica&v=1.2


Исследователи должны соблюдать следующие права:

Публикующей организацией и владельцем прав на данную работу является SCAR - Microbial Antarctic Resource System. This work is licensed under a Creative Commons Attribution (CC-BY) 4.0 License.

Регистрация в GBIF

Этот ресурс был зарегистрирован в GBIF, ему был присвоен следующий UUID: 7c5815a5-7909-418b-87dc-af0cab0e57ce.  SCAR - Microbial Antarctic Resource System отвечает за публикацию этого ресурса, и зарегистрирован в GBIF как издатель данных при оподдержке Scientific Committee on Antarctic Research.

Ключевые слова



Кто является создателем ресурса:

Kevin Newsham
British Antarctic Survey
David Hopkins
The Royal Agricultural University
Lilia Carvalhais
The University of Queensland
Peter Fretwell
British Antarctic Survey
Steven Rushton
Newcastle University
Newcastle upon Tyne
Anthony O'Donnell
University of Western Australia
Paul Dennis
The University of Queensland

Кто может ответить на вопросы о ресурсе:

Kevin Newsham
British Antarctic Survey
Paul Dennis
The University of Queensland

Кем заполнены метаданные:

Maxime Sweetlove
Research assistent
Royal Belgian Institute for Natural Sciences
Rue Vautier 29
1000 Brussels

Кто еще связан с данным ресурсом:

Географический охват

Soil samples from the Antarctic Peninsula and Maritime Antarctic Islands.

Ограничивающие координаты Юг Запад [-71,878, -71,844], Север Восток [-60,701, -45,661]
Таксономический охват

microbial soil Fungi, ITS2 marker gene

Phylum  Fungi (Fungi)
Данные проекта

Описание отсутсвует

Название Microbial soil Fungi (ITS2) diversity from Maritime Antarctica
Финансирование This work was funded by a UK Natural Environment Research Council Antarctic Funding Initiative grant (NE/D00893X/1; AFI 7/05) and a University of Queensland Early Career Researcher Award.

Исполнители проекта:

David Hopkins
Методы сбора

The uppermost five centimetres of soil was collected in 50 ml DNA/RNAase-treated plastic tubes (30 mm diam.) from each of five locations at each site and was bulked. The soil was then immediately snap-frozen by immersion in a mixture of dry ice and ethanol (c. -80 °C). Samples were maintained at -80 °C from the time of sampling until they were processed.

Охват исследования Soils without plant cover were sampled along the climatic gradient in Maritime Antarctica.

Описание этапа методики:

  1. Total DNA was extracted under sterile conditions from 10 g of soil using a PowerMax® Soil DNA isolation kit (MO BIO Laboratories, Inc., Carlsbad, CA, USA) as per the manufacturer’s instructions. The internal transcribed spacer 2 (ITS2) region of the ribosomal RNA encoding genes was amplified by polymerase chain reaction (PCR) using the primers gITS7 (5′ GTGARTCATCGARTCTTTG27) and ITS4 (5′ TCCTCCGCTTATTGATATGC28), which target sites in the 5.8S gene and ribosomal large subunit, respectively. The gITS7 primer was 5’-labelled with the 454 FLX sequencing primer adapter B sequence and the ITS4 primer was 5’-labelled with a sample specific barcode sequence and the 454 FLX sequencing primer adapter A sequence. PCRs were performed in duplicate 50 μl reactions, each containing 5 ng template DNA, 1X Phusion® High Fidelity PCR Buffer (New England Biolabs Inc.), 0.2 mM of each of the dNTPs (Invitrogen), 0.3 μM of the ITS4 primer, 0.5 μM of the gITS7 primer, and 1U of 1X Phusion® High Fidelity DNA Polymerase (New England Biolabs Inc.). Thermocycling conditions were as follows: 98 °C for 30 s, 35 cycles of 98 °C for 10 s, 56 °C for 30 s, 72 °C for 15 s and a final extension at 72 °C for 7 min. Negative controls, consisting of sterile water in place of template DNA, did not yield amplicons. Amplicons were purified using a Wizard® SV Gel and PCR Clean-Up System (Promega), quantified with a Qubit fluorometer with a Quant-iT dsDNA HF assay kit and then 72 ng of each sample was pooled. The pooled sample was purified again using a QIAquick PCR Purification Kit (Qiagen), and then sent to Macrogen (Seoul, Korea) for 454 pyrosequencing.
Библиографические ссылки
  1. Newsham, K. K., Hopkins, D. W., Carvalhais, L. C., Fretwell, P. T., Rushton, S. P., O’Donnell, A. G., & Dennis, P. G. (2016). Relationship between soil fungal diversity and temperature in the maritime Antarctic. Nature Climate Change, 6(2), 182.
Дополнительные метаданные
Альтернативные идентификаторы 7c5815a5-7909-418b-87dc-af0cab0e57ce