Integrated Publishing Toolkit(IPT)

free and open access to biodiversity data

Microbial soil Fungi (ITS2) diversity from Maritime Antarctica

Latest version published by SCAR - Microbial Antarctic Resource System on Jan 8, 2019 SCAR - Microbial Antarctic Resource System

Amplicon sequencing dataset (454) of microbial fungi (ITS2 marker gene) in soils from the Antarctic Peninsula and Maritime Antarctic Islands.


Download the latest version of the metadata-only resource metadata as EML or RTF:

Metadata as an EML file download in English (10 KB)
Metadata as an RTF file download in English (9 KB)


The table below shows only published versions of the resource that are publicly accessible.

How to cite

Researchers should cite this work as follows:

Newsham K, Hopkins D, Carvalhais L, Fretwell P, Rushton S, O'Donnell A, Dennis P (2019): Microbial soil Fungi (ITS2) diversity from Maritime Antarctica. v1.0. SCAR - Microbial Antarctic Resource System. Dataset/Metadata.


Researchers should respect the following rights statement:

The publisher and rights holder of this work is SCAR - Microbial Antarctic Resource System. This work is licensed under a Creative Commons Attribution (CC-BY) 4.0 License.

GBIF Registration

This resource has been registered with GBIF, and assigned the following GBIF UUID: 7c5815a5-7909-418b-87dc-af0cab0e57ce.  SCAR - Microbial Antarctic Resource System publishes this resource, and is itself registered in GBIF as a data publisher endorsed by Scientific Committee on Antarctic Research.




Who created the resource:

Kevin Newsham
Adjunct professor
British Antarctic Survey Cambridge GB
David Hopkins
The Royal Agricultural University Cirencester GB
Lilia Carvalhais
Research fellow
The University of Queensland Brisbane AU
Peter Fretwell
Geographic information officer
British Antarctic Survey Cambridge GB
Steven Rushton
Newcastle University Newcastle upon Tyne GB
Anthony O'Donnell
University of Western Australia Crawley AU
Paul Dennis
Senior lecturer
The University of Queensland Brisbane AU

Who can answer questions about the resource:

Kevin Newsham
Adjunct professor
British Antarctic Survey Cambridge GB
Paul Dennis
Senior lecturer
The University of Queensland Brisbane AU

Who filled in the metadata:

Maxime Sweetlove
Research assistent
Royal Belgian Institute for Natural Sciences Rue Vautier 29 1000 Brussels BE

Who else was associated with the resource:


Geographic Coverage

Soil samples from the Antarctic Peninsula and Maritime Antarctic Islands.

Bounding Coordinates South West [-71.878, -71.844], North East [-60.701, -45.661]

Taxonomic Coverage

microbial soil Fungi, ITS2 marker gene

Phylum  Fungi (Fungi)

Project Data

No Description available

Title Microbial soil Fungi (ITS2) diversity from Maritime Antarctica
Funding This work was funded by a UK Natural Environment Research Council Antarctic Funding Initiative grant (NE/D00893X/1; AFI 7/05) and a University of Queensland Early Career Researcher Award.

The personnel involved in the project:

David Hopkins

Sampling Methods

The uppermost five centimetres of soil was collected in 50 ml DNA/RNAase-treated plastic tubes (30 mm diam.) from each of five locations at each site and was bulked. The soil was then immediately snap-frozen by immersion in a mixture of dry ice and ethanol (c. -80 °C). Samples were maintained at -80 °C from the time of sampling until they were processed.

Study Extent Soils without plant cover were sampled along the climatic gradient in Maritime Antarctica.

Method step description:

  1. Total DNA was extracted under sterile conditions from 10 g of soil using a PowerMax® Soil DNA isolation kit (MO BIO Laboratories, Inc., Carlsbad, CA, USA) as per the manufacturer’s instructions. The internal transcribed spacer 2 (ITS2) region of the ribosomal RNA encoding genes was amplified by polymerase chain reaction (PCR) using the primers gITS7 (5′ GTGARTCATCGARTCTTTG27) and ITS4 (5′ TCCTCCGCTTATTGATATGC28), which target sites in the 5.8S gene and ribosomal large subunit, respectively. The gITS7 primer was 5’-labelled with the 454 FLX sequencing primer adapter B sequence and the ITS4 primer was 5’-labelled with a sample specific barcode sequence and the 454 FLX sequencing primer adapter A sequence. PCRs were performed in duplicate 50 μl reactions, each containing 5 ng template DNA, 1X Phusion® High Fidelity PCR Buffer (New England Biolabs Inc.), 0.2 mM of each of the dNTPs (Invitrogen), 0.3 μM of the ITS4 primer, 0.5 μM of the gITS7 primer, and 1U of 1X Phusion® High Fidelity DNA Polymerase (New England Biolabs Inc.). Thermocycling conditions were as follows: 98 °C for 30 s, 35 cycles of 98 °C for 10 s, 56 °C for 30 s, 72 °C for 15 s and a final extension at 72 °C for 7 min. Negative controls, consisting of sterile water in place of template DNA, did not yield amplicons. Amplicons were purified using a Wizard® SV Gel and PCR Clean-Up System (Promega), quantified with a Qubit fluorometer with a Quant-iT dsDNA HF assay kit and then 72 ng of each sample was pooled. The pooled sample was purified again using a QIAquick PCR Purification Kit (Qiagen), and then sent to Macrogen (Seoul, Korea) for 454 pyrosequencing.

Bibliographic Citations

  1. Newsham, K. K., Hopkins, D. W., Carvalhais, L. C., Fretwell, P. T., Rushton, S. P., O’Donnell, A. G., & Dennis, P. G. (2016). Relationship between soil fungal diversity and temperature in the maritime Antarctic. Nature Climate Change, 6(2), 182.