Antarctic cryptoendolithic fungal communities ITS amplicon sequencing

Dernière version Publié par SCAR - Microbial Antarctic Resource System le Mar 19, 2019 SCAR - Microbial Antarctic Resource System

Amplicon sequencing dataset of cryptoendolithic (sandstone) fungal communities (ITS1 marker gene) in Victoria Land (continental Antarctica).

Téléchargements

Téléchargez la dernière version de la ressource "Métadonnées uniquement" au format EML ou RTF :

Métadonnées sous forme de fichier EML télécharger dans Anglais (10 KB)
Métadonnées sous forme de fichier RTF télécharger dans Anglais (11 KB)

Versions

Le tableau ci-dessous n'affiche que les versions publiées de la ressource accessibles publiquement.

Comment citer

Les chercheurs doivent citer cette ressource comme suit:

Coleine C, Zucconi L, Onofri S, Pombubpa N, Stajich J, Selbman L (2018): Antarctic cryptoendolithic fungal communities ITS amplicon sequencing. v1.2. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=antarctic_cryptoendolithic_microbial_fungi_its&v=1.2

Droits

Les chercheurs doivent respecter la déclaration de droits suivante:

L’éditeur et détenteur des droits de cette ressource est SCAR - Microbial Antarctic Resource System. This work is licensed under a Creative Commons Attribution (CC-BY) 4.0 License.

Enregistrement GBIF

Cette ressource a été enregistrée sur le portail GBIF, et possède l'UUID GBIF suivante : b94f714c-e890-4365-81a5-968a20606d37.  SCAR - Microbial Antarctic Resource System publie cette ressource, et est enregistré dans le GBIF comme éditeur de données avec l'approbation du Scientific Committee on Antarctic Research.

Mots-clé

Metadata

Contacts

Personne ayant créé cette ressource:

Claudia Coleine
University of Tuscia Viterbo IT
Laura Zucconi
University of Tuscia Viterbo IT
Silvano Onofri
University of Tuscia Viterbo IT
Nuttapon Pombubpa
University of California US
Jason Stajich
University of California US
Laura Selbman
University of Tuscia Viterbo IT

Personne pouvant répondre aux questions sur la ressource:

Claudia Coleine
University of Tuscia Viterbo IT

Personne ayant renseigné les métadonnées:

Maxime Sweetlove
Research assistent
Royal Belgian Institute of Natural Sciences Rue Vautier 29 1000 Brussels

Autres personnes associées à la ressource:

Utilisateur
Maxime Sweetlove

Couverture géographique

Victoria Land (Continental Antarctica)

Enveloppe géographique Sud Ouest [-77.91, 159.233], Nord Est [-74.169, 162.514]

Couverture taxonomique

microbial fungi (ITS1)

Phylum  Fungi (Fungi)

Données sur le projet

Pas de description disponible

Titre Antarctic cryptoendolithic fungal communities
Financement Sequencing was supported by funds through United States Department of Agriculture—National Institute of Food and Agriculture Hatch project CA-R-PPA-5062-H. Data analyses were performed on the High-Performance Computing Cluster at the University of California-Riverside in the Institute of Integrative Genome Biology supported by NSF DBI-1429826 and NIH S10-OD016290. Additional support was given through a Royal Thai government fellowship.

Les personnes impliquées dans le projet:

Claudia Coleine

Méthodes d'échantillonnage

Rock samples were excised aseptically, transported, and stored at −20 °C at the Tuscia University (Viterbo, Italy) until processing.

Etendue de l'étude Sandstone rock samples were collected in triplicate in Victoria Land (Continental Antarctica), along a latitudinal transect from 74°10′10.5′′ S 162°25′38.0′′ E (Timber Peak, Northern Victoria Land) to 77°54′43.6′′ S 161°34′39.3′′ E (Finger Mt., Southern Victoria Land) ranging from 834 m a.s.l. (Battleship Promontory, Southern Victoria Land) to 3100 m a.s.l. (Mt. New Zealand, Northern Victoria Land). In addition, rocks with different sun exposures were collected from four visited sites (Battleship Promontory, Siegfried Peak, Finger Mt. and University Valley). All sites were visited during the XXXII Italian Antarctic Expedition (2015–2016).

Description des étapes de la méthode:

  1. Rocks were crushed using a Grinder MM 400 RETSCH (Verder Scientific, Bologna, Italy) in sterile conditions to avoid contamination.
  2. Metagenomic DNA was extracted from 0.3 g of rocks using MOBIO Power Soil DNA Extraction kit (MOBIO Laboratories, Carlsbad, CA, USA), according to the manufacturer’s instructions. ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2 (GCTGCGTTCTTCATCGATGC) primers were used to amplify the internal transcribed spacer 1 region (ITS1). PCR reactions were performed in a total volume of 25 μL, containing 1 μL of each primer, 12.5 μL of Taq DNA Polymerase (Thermo Fischer Scientific Inc., Waltham, MA, USA), 9.5 μL of nuclease-free water (Sigma-Aldrich, St. Louis, MO, USA) and 5 ng of DNA, following Coleine et al. PCR conditions were initial denaturation at 93 °C for 3 min, 35 cycles of denaturation at 95 °C for 45 s, annealing at 50 °C for 1 min, extension at 72°C for 90 s, followed by a final extension at 72 °C for 10 min in an automated thermal cycler (BioRad, Hercules, CA, USA). Amplicons, purified with Qiagen PCR CleanUp kit (Macherey-Nagel, Hoerdt, France) and quantified using the Qubit dsDNA HS Assay Kit (Life Technologies, Carlsbad, CA, USA), were tagged with unique barcodes to enable identification of each sample, and then pooled for run sequencing.
  3. Sequencing (paired-end reads, 2 × 300 bp) of the pooled libraries was performed on a single Illumina MiSeq flowcell at the Institute for Integrative Genome Biology, University of California, Riverside.

Citations bibliographiques

  1. Coleine, C., Zucconi, L., Onofri, S., Pombubpa, N., Stajich, J., & Selbmann, L. (2018). Sun Exposure Shapes Functional Grouping of Fungi in Cryptoendolithic Antarctic Communities. Life, 8(2), 19.

Métadonnées additionnelles

Identifiants alternatifs b94f714c-e890-4365-81a5-968a20606d37
https://ipt.biodiversity.aq/resource?r=antarctic_cryptoendolithic_microbial_fungi_its