Antarctic cryptoendolithic fungal communities ITS amplicon sequencing

Metadata-only
Latest version published by SCAR - Microbial Antarctic Resource System on Mar 19, 2019 SCAR - Microbial Antarctic Resource System
Publication date:
19 March 2019
License:
CC-BY 4.0

Download the latest version of the metadata-only resource metadata as EML or RTF:

Metadata as an EML file download in English (10 KB)
Metadata as an RTF file download in English (12 KB)

Description

Amplicon sequencing dataset of cryptoendolithic (sandstone) fungal communities (ITS1 marker gene) in Victoria Land (continental Antarctica).

Versions

The table below shows only published versions of the resource that are publicly accessible.

How to cite

Researchers should cite this work as follows:

Coleine C, Zucconi L, Onofri S, Pombubpa N, Stajich J, Selbman L (2018): Antarctic cryptoendolithic fungal communities ITS amplicon sequencing. v1.2. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=antarctic_cryptoendolithic_microbial_fungi_its&v=1.2

Rights

Researchers should respect the following rights statement:

The publisher and rights holder of this work is SCAR - Microbial Antarctic Resource System. This work is licensed under a Creative Commons Attribution (CC-BY 4.0) License.

GBIF Registration

This resource has been registered with GBIF, and assigned the following GBIF UUID: b94f714c-e890-4365-81a5-968a20606d37.  SCAR - Microbial Antarctic Resource System publishes this resource, and is itself registered in GBIF as a data publisher endorsed by Scientific Committee on Antarctic Research.

Keywords

Metadata

Contacts

Claudia Coleine
  • Originator ●
  • Point Of Contact
University of Tuscia
Viterbo
IT
Laura Zucconi
  • Originator
University of Tuscia
Viterbo
IT
Silvano Onofri
  • Originator
University of Tuscia
Viterbo
IT
Nuttapon Pombubpa
  • Originator
University of California
US
Jason Stajich
  • Originator
University of California
US
Laura Selbman
  • Originator
University of Tuscia
Viterbo
IT
Maxime Sweetlove
  • User
  • Research assistent
Royal Belgian Institute of Natural Sciences
  • Rue Vautier 29
1000 Brussels
Maxime Sweetlove
  • User

Geographic Coverage

Victoria Land (Continental Antarctica)

Bounding Coordinates South West [-77.91, 159.233], North East [-74.169, 162.514]

Taxonomic Coverage

microbial fungi (ITS1)

Phylum Fungi (Fungi)

Project Data

No Description available

Title Antarctic cryptoendolithic fungal communities
Funding Sequencing was supported by funds through United States Department of Agriculture—National Institute of Food and Agriculture Hatch project CA-R-PPA-5062-H. Data analyses were performed on the High-Performance Computing Cluster at the University of California-Riverside in the Institute of Integrative Genome Biology supported by NSF DBI-1429826 and NIH S10-OD016290. Additional support was given through a Royal Thai government fellowship.

The personnel involved in the project:

Claudia Coleine

Sampling Methods

Rock samples were excised aseptically, transported, and stored at −20 °C at the Tuscia University (Viterbo, Italy) until processing.

Study Extent Sandstone rock samples were collected in triplicate in Victoria Land (Continental Antarctica), along a latitudinal transect from 74°10′10.5′′ S 162°25′38.0′′ E (Timber Peak, Northern Victoria Land) to 77°54′43.6′′ S 161°34′39.3′′ E (Finger Mt., Southern Victoria Land) ranging from 834 m a.s.l. (Battleship Promontory, Southern Victoria Land) to 3100 m a.s.l. (Mt. New Zealand, Northern Victoria Land). In addition, rocks with different sun exposures were collected from four visited sites (Battleship Promontory, Siegfried Peak, Finger Mt. and University Valley). All sites were visited during the XXXII Italian Antarctic Expedition (2015–2016).

Method step description:

  1. Rocks were crushed using a Grinder MM 400 RETSCH (Verder Scientific, Bologna, Italy) in sterile conditions to avoid contamination.
  2. Metagenomic DNA was extracted from 0.3 g of rocks using MOBIO Power Soil DNA Extraction kit (MOBIO Laboratories, Carlsbad, CA, USA), according to the manufacturer’s instructions. ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2 (GCTGCGTTCTTCATCGATGC) primers were used to amplify the internal transcribed spacer 1 region (ITS1). PCR reactions were performed in a total volume of 25 μL, containing 1 μL of each primer, 12.5 μL of Taq DNA Polymerase (Thermo Fischer Scientific Inc., Waltham, MA, USA), 9.5 μL of nuclease-free water (Sigma-Aldrich, St. Louis, MO, USA) and 5 ng of DNA, following Coleine et al. PCR conditions were initial denaturation at 93 °C for 3 min, 35 cycles of denaturation at 95 °C for 45 s, annealing at 50 °C for 1 min, extension at 72°C for 90 s, followed by a final extension at 72 °C for 10 min in an automated thermal cycler (BioRad, Hercules, CA, USA). Amplicons, purified with Qiagen PCR CleanUp kit (Macherey-Nagel, Hoerdt, France) and quantified using the Qubit dsDNA HS Assay Kit (Life Technologies, Carlsbad, CA, USA), were tagged with unique barcodes to enable identification of each sample, and then pooled for run sequencing.
  3. Sequencing (paired-end reads, 2 × 300 bp) of the pooled libraries was performed on a single Illumina MiSeq flowcell at the Institute for Integrative Genome Biology, University of California, Riverside.

Bibliographic Citations

  1. Coleine, C., Zucconi, L., Onofri, S., Pombubpa, N., Stajich, J., & Selbmann, L. (2018). Sun Exposure Shapes Functional Grouping of Fungi in Cryptoendolithic Antarctic Communities. Life, 8(2), 19.

Additional Metadata

Alternative Identifiers b94f714c-e890-4365-81a5-968a20606d37
https://ipt.biodiversity.aq/resource?r=antarctic_cryptoendolithic_microbial_fungi_its