Bacteria (16S) in Antarctic terrestrial soils of the Sor Rondane Mountains
Latest version published by SCAR - Microbial Antarctic Resource System on Mar 19, 2019
Illumina sequencing data of bacterial communities in 52 soil samples from the western Sør Rondane Mountains (Dronning Maud Land, East Antarctica).The samples were taken along broad environmental gradients, including different types of bedrock, in an area covering nearly 1000 km2.
Versions
The table below shows only published versions of the resource that are publicly accessible.
How to cite
Researchers should cite this work as follows:
Tytgat B, Vyverman W, Willems A, Verleyen E (2018): Bacteria (16S) in Antarctic terrestrial soils of the Sor Rondane Mountains. v1.4. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_terrestrial_soils&v=1.4
Rights
Researchers should respect the following rights statement:
The publisher and rights holder of this work is SCAR - Microbial Antarctic Resource System. This work is licensed under a Creative Commons Attribution (CC-BY) 4.0 License.
GBIF Registration
This resource has been registered with GBIF, and assigned the following GBIF UUID: fcef9fcc-f737-46a1-b44e-edde5c5789a2. SCAR - Microbial Antarctic Resource System publishes this resource, and is itself registered in GBIF as a data publisher endorsed by Scientific Committee on Antarctic Research.
Keywords
Metadata
Contacts
Who created the resource:
Who can answer questions about the resource:
Who filled in the metadata:
Who else was associated with the resource:
Geographic Coverage
Sor Ronda Mountains, East Antarctica
Bounding Coordinates | South West [-72.1, 22.7], North East [-71.8, 24.6] |
---|
Taxonomic Coverage
16S ssh rRNA gene of Bacteria, using the primers pA (AGAGTTTGATCCTGGCTCAG, positions 8–27) and BKL1 (GTATTACCGCGGCTGCTGGCA, positions 536–516)
Domain | Bacteria (bacteria) |
---|
Temporal Coverage
Start Date / End Date | 2009-01-01 / 2010-01-01 |
---|
Project Data
No Description available
Title | BELDIVA-AMBIO |
---|---|
Funding | This research was funded by the Special Research Fund BOF of (grant ) and by the Belgian Science Policy Office (BelSPO) projects BELDIVA (EA/00/05), AMBIO (SD/BA/01A) and CCAMBIO (SD/BA/03A). A. Wilmotte is Research Associate of the FRS-FNRS. This study is a contribution to the State of the Antarctic Ecosystem (AntEco) research program of the Scientific Committee on Antarctic Research (SCAR). |
Study Area Description | The Sop Ronda Mountains (SRM) (22° E-28° E, 71°30′ S-72°40′ S) are a 220 km long, east-west oriented mountain range, situated about 200 km inland, with peaks reaching 3300 m a.s.l. The bedrock is mainly metamorphic (e.g. gneiss) with some plutonic (granite) outcrops. |
The personnel involved in the project:
Bibliographic Citations
- Tytgat, B., Verleyen, E., Sweetlove, M., D'hondt, S., Clercx, P., Van Ranst, E., ... & Vyverman, W. (2016). Bacterial community composition in relation to bedrock type and macrobiota in soils from the Sør Rondane Mountains, East Antarctica. FEMS microbiology ecology, 92(9).
Additional Metadata
Alternative Identifiers | fcef9fcc-f737-46a1-b44e-edde5c5789a2 |
---|---|
https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_terrestrial_soils |