Downloads
Download the latest version of the metadata-only resource metadata as EML or RTF:
Versions
The table below shows only published versions of the resource that are publicly accessible.
How to cite
Researchers should cite this work as follows:
Tytgat B, Vyverman W, Willems A, Verleyen E (2018): Bacteria (16S) in Antarctic terrestrial soils of the Sor Rondane Mountains. v1.4. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_terrestrial_soils&v=1.4
Rights
Researchers should respect the following rights statement:
The publisher and rights holder of this work is SCAR - Microbial Antarctic Resource System. This work is licensed under a Creative Commons Attribution (CC-BY) 4.0 License.
GBIF Registration
This resource has been registered with GBIF, and assigned the following GBIF UUID: fcef9fcc-f737-46a1-b44e-edde5c5789a2. SCAR - Microbial Antarctic Resource System publishes this resource, and is itself registered in GBIF as a data publisher endorsed by Scientific Committee on Antarctic Research.
Keywords
Metadata
Contacts
Who created the resource:
Who can answer questions about the resource:
Who filled in the metadata:
Who else was associated with the resource:
Geographic Coverage
Sor Ronda Mountains, East Antarctica
Bounding Coordinates | South West [-72.1, 22.7], North East [-71.8, 24.6] |
---|
Taxonomic Coverage
16S ssh rRNA gene of Bacteria, using the primers pA (AGAGTTTGATCCTGGCTCAG, positions 8–27) and BKL1 (GTATTACCGCGGCTGCTGGCA, positions 536–516)
Domain | Bacteria (bacteria) |
---|
Temporal Coverage
Start Date / End Date | 2009-01-01 / 2010-01-01 |
---|
Project Data
No Description available
Title | BELDIVA-AMBIO |
---|---|
Funding | This research was funded by the Special Research Fund BOF of (grant ) and by the Belgian Science Policy Office (BelSPO) projects BELDIVA (EA/00/05), AMBIO (SD/BA/01A) and CCAMBIO (SD/BA/03A). A. Wilmotte is Research Associate of the FRS-FNRS. This study is a contribution to the State of the Antarctic Ecosystem (AntEco) research program of the Scientific Committee on Antarctic Research (SCAR). |
Study Area Description | The Sop Ronda Mountains (SRM) (22° E-28° E, 71°30′ S-72°40′ S) are a 220 km long, east-west oriented mountain range, situated about 200 km inland, with peaks reaching 3300 m a.s.l. The bedrock is mainly metamorphic (e.g. gneiss) with some plutonic (granite) outcrops. |
The personnel involved in the project:
Bibliographic Citations
- Tytgat, B., Verleyen, E., Sweetlove, M., D'hondt, S., Clercx, P., Van Ranst, E., ... & Vyverman, W. (2016). Bacterial community composition in relation to bedrock type and macrobiota in soils from the Sør Rondane Mountains, East Antarctica. FEMS microbiology ecology, 92(9).
Additional Metadata
Alternative Identifiers | fcef9fcc-f737-46a1-b44e-edde5c5789a2 |
---|---|
https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_terrestrial_soils |