Bacterial Diversity Assessment in Antarctic Terrestrial and Aquatic Microbial Mats

Dernière version Publié par SCAR - Microbial Antarctic Resource System le Mar 19, 2019 SCAR - Microbial Antarctic Resource System

Bacterial data (16S rRNA) from terrestrial and aquatic Microbial mats in continental Antarctic.

Téléchargements

Téléchargez la dernière version de la ressource "Métadonnées uniquement" au format EML ou RTF :

Métadonnées sous forme de fichier EML télécharger dans Anglais (15 KB)
Métadonnées sous forme de fichier RTF télécharger dans Anglais (13 KB)

Versions

Le tableau ci-dessous n'affiche que les versions publiées de la ressource accessibles publiquement.

Comment citer

Les chercheurs doivent citer cette ressource comme suit:

Tytgat B, Vrleyen E, Obbels D, Peeters K, De Wever A, D'hondt S, De Meyer T, van Criekinge W, Vyverman W, Willems A (2018): Bacterial Diversity Assessment in Antarctic Terrestrial and Aquatic Microbial Mats. v1.1. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=bacterial_diversity_antarctica_microbial_mats&v=1.1

Droits

Les chercheurs doivent respecter la déclaration de droits suivante:

L’éditeur et détenteur des droits de cette ressource est SCAR - Microbial Antarctic Resource System. This work is licensed under a Creative Commons Attribution (CC-BY) 4.0 License.

Enregistrement GBIF

Cette ressource a été enregistrée sur le portail GBIF, et possède l'UUID GBIF suivante : f3a8b1d6-a1d1-4292-8a7e-19c63a0825bd.  SCAR - Microbial Antarctic Resource System publie cette ressource, et est enregistré dans le GBIF comme éditeur de données avec l'approbation du Scientific Committee on Antarctic Research.

Mots-clé

lake; soil; bacteria; antarctica; 16S

Contacts

Personne ayant créé cette ressource:

Bjorn Tytgat
Post doctoral assistent
Ghent University Krijgslaan 281 9000 Gent BE
Elie Vrleyen
Professor
Ghent University Krijgslaan 281 9000 Gent BE
Dagmar Obbels
PhD student
Ghent University Krijgslaan 281 9000 Gent BE
Karolien Peeters
Post doctoral researcher
Ghent University Krijgslaan 281 9000 Gent BE
Aake De Wever
Post doctoral assistent
Royal Belgian Institute for Natural Sciences Krijgslaan 281 1000 Brussels BE
Sofie D'hondt
Lab technician
Ghent University
Tim De Meyer
Professor
Ghent University
Wim van Criekinge
Post doctoral researcher
GhentUniversity
Wim Vyverman
Professor
Ghent University
Anne Willems
Professor
Ghent Univeristy

Personne pouvant répondre aux questions sur la ressource:

Bjorn Tytgat
Post doctoral assistent
Ghent University Krijgslaan 281 9000 Gent BE

Personne ayant renseigné les métadonnées:

Maxime Sweetlove
Royal Belgian Institute for Natural Sciences Rue Vautier 29 1000 Brussels BE

Autres personnes associées à la ressource:

Fournisseur de Contenu
Bjorn Tytgat
Post doctoral assistent
Ghent University Krijgslaan 281 9000 Gent BE
Fournisseur de Contenu
Karolien Peeters
Post doctoral researcher
Ghent University 9000 Gent BE
Fournisseur de Contenu
Anne Willems
Professor
Ghent University 9000 Gent BE

Couverture géographique

soil samples and lake samples from East Antarctica

Enveloppe géographique Sud Ouest [-80.45, -67.45], Nord Est [-67.7, 39.8]

Couverture taxonomique

Bacterial 16S amplicons (V1-V3 region)

Domain  Bacteria (Bacteria)

Couverture temporelle

Date de début / Date de fin 2003-01-01 / 2007-01-01

Données sur le projet

CCAMBIO (Climate Change and Antarctic Microbial Biodiversity) is an academic project funded by the Belgian Federal Science Policy (BELSPO). Its main objective is to study the diversity, biogeographic zoning and genomic make-up of lacustrine microbial mat communities in the Antarctic Realm. CCAMBIO is composed by researchers from four Belgian Universities and Institutes (University of Liège, Ghent University, National Botanical Garden of Belgium and Royal Belgian Institute of Natural Sciences), as well as collaborators from the British Antarctic Survey.

Titre CCAMBIO
Identifiant CCAMBIO
Financement Belgian Science Policy Office (BelSPO) project SD/BA/03

Les personnes impliquées dans le projet:

Bjorn Tytgat
Elie Verleyen
Dagmar Obbels
Anne Willems
Wim Vyverman

Méthodes d'échantillonnage

Two terrestrial and seven limnetic microbial mat samples were collected aseptically during different field campaigns in December/January 2003 (PQ1, TM2 and TM4) and in January 2007 (BB50, BB115, LA3, SK5, WO10 and SO6). All samples were kept frozen during transport and stored at 220uC.

Etendue de l'étude One sample (PQ1) was collected on Pourquoi-Pas Island off the west coast of Graham Land (Antarctic Peninsula). All other samples were collected from Eastern Antarctic habitats. The two terrestrial microbial mat samples (BB50 and BB115) were taken near the Utsteinen nunatak in the Sør Rondane Mountains (Dronning Maud Land). Three samples were from Lu ̈tzow-Holm Bay (Dronning Maud Land), namely from a small saline lake in Langhovde (LA3), from Naka-Tempyo Lake (SK5) in Skarvsnes, and from a small saline pond (WO10) in West Ongul Island. One sample (SO6) was taken from Lake Melkoye (unofficial name) in Schirmacher Oasis (Dronning Maud Land). The two remaining samples were collected in the Transantarctic Mountains. Sample TM2 was taken from Forlidas Pond (Dufek Massif, Pensacola Mountains), while sample TM4 was taken from Lundstro ̈m Lake (Shackleton Range).

Description des étapes de la méthode:

  1. DNA was extracted from frozen samples using 5 g per sample. Extracellular DNA was first removed as described by Corinaldesi et al. and DNA extraction was subsequently performed according to Zwart et al. Sequencing of the 16S rRNA V1–V3 regions was performed using forward primer pA (AGAGTTTGATCCTGGCTCAG 8–27) and reverse primer BKL1 (GTATTACCGCGGCTGCTGGCA 536– 516). Because it proved impossible to concatenate the comple- mentary reads due to insufficient overlap, the forward and reverse sequences were analyzed separately. The forward reads hence cover the complete V1 and V2 regions, whereas the reverse reads cover the V3 and part of the V2 region for the longest sequences.
  2. Multiplexing was done with barcodes proposed by Parames- waran et al. Each PCR mixture contained 1–2 ml of template DNA, 2 ml of fusion primers and barcodes (10 mM), 2.5 ml dNTPs (10 mM), 1.5 ml of 10x buffer, 0.25 ml of 5 U/ml FastStart High Fidelity Polymerase (Roche) and was adjusted to a final volume of 25 ml with sterile HPLC-water. PCR cycling included 3 min at 94uC, followed by 35 cycles of 94uC for 30 s, 55uC for 60 s and 72uC for 90 s and finally 8 min at 72uC. PCR products were purified using a High Pure PCR Product Purification Kit (Roche).
  3. Pyrosequencing was performed on a Roche 454 GS FLX Titanium machine at NXTGNT (Ghent, Belgium) after quality control of the DNA with a Qubit 2.0 Fluorometer (Life Technologies) and a Bioanalyzer (Agilent Technologies).

Citations bibliographiques

  1. Tytgat, B., Verleyen, E., Obbels, D., Peeters, K., De Wever, A., D’hondt, S., ... & Willems, A. (2014). Bacterial diversity assessment in Antarctic terrestrial and aquatic microbial mats: a comparison between bidirectional pyrosequencing and cultivation. PloS one, 9(6), e97564.

Métadonnées additionnelles

Identifiants alternatifs f3a8b1d6-a1d1-4292-8a7e-19c63a0825bd
https://ipt.biodiversity.aq/resource?r=bacterial_diversity_antarctica_microbial_mats