Antarctic cryptoendolithic fungal communities ITS amplicon sequencing

Somente metadatos
Versão mais recente published by SCAR - Microbial Antarctic Resource System on mar 19, 2019 SCAR - Microbial Antarctic Resource System
Publication date:
19 de março de 2019
Licença:
CC-BY 4.0

Baixe a versão mais recente dos metadados como EML ou RTF:

Metadados como um arquivo EML download em English (10 KB)
Metadados como um arquivo RTF download em English (12 KB)

Descrição

Amplicon sequencing dataset of cryptoendolithic (sandstone) fungal communities (ITS1 marker gene) in Victoria Land (continental Antarctica).

Versões

A tabela abaixo mostra apenas versões de recursos que são publicamente acessíveis.

Como citar

Pesquisadores deveriam citar esta obra da seguinte maneira:

Coleine C, Zucconi L, Onofri S, Pombubpa N, Stajich J, Selbman L (2018): Antarctic cryptoendolithic fungal communities ITS amplicon sequencing. v1.2. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=antarctic_cryptoendolithic_microbial_fungi_its&v=1.2

Direitos

Pesquisadores devem respeitar a seguinte declaração de direitos:

O editor e o detentor dos direitos deste trabalho é SCAR - Microbial Antarctic Resource System. This work is licensed under a Creative Commons Attribution (CC-BY 4.0) License.

GBIF Registration

Este recurso foi registrado no GBIF e atribuído ao seguinte GBIF UUID: b94f714c-e890-4365-81a5-968a20606d37.  SCAR - Microbial Antarctic Resource System publica este recurso, e está registrado no GBIF como um publicador de dados aprovado por Scientific Committee on Antarctic Research.

Palavras-chave

Metadata

Contatos

Claudia Coleine
  • Originador ●
  • Ponto De Contato
University of Tuscia
Viterbo
IT
Laura Zucconi
  • Originador
University of Tuscia
Viterbo
IT
Silvano Onofri
  • Originador
University of Tuscia
Viterbo
IT
Nuttapon Pombubpa
  • Originador
University of California
US
Jason Stajich
  • Originador
University of California
US
Laura Selbman
  • Originador
University of Tuscia
Viterbo
IT
Maxime Sweetlove
  • Usuário
  • Research assistent
Royal Belgian Institute of Natural Sciences
  • Rue Vautier 29
1000 Brussels
Maxime Sweetlove
  • Usuário

Cobertura Geográfica

Victoria Land (Continental Antarctica)

Coordenadas delimitadoras Sul Oeste [-77,91, 159,233], Norte Leste [-74,169, 162,514]

Cobertura Taxonômica

microbial fungi (ITS1)

Filo Fungi (Fungi)

Dados Sobre o Projeto

Nenhuma descrição disponível

Título Antarctic cryptoendolithic fungal communities
Financiamento Sequencing was supported by funds through United States Department of Agriculture—National Institute of Food and Agriculture Hatch project CA-R-PPA-5062-H. Data analyses were performed on the High-Performance Computing Cluster at the University of California-Riverside in the Institute of Integrative Genome Biology supported by NSF DBI-1429826 and NIH S10-OD016290. Additional support was given through a Royal Thai government fellowship.

O pessoal envolvido no projeto:

Claudia Coleine

Métodos de Amostragem

Rock samples were excised aseptically, transported, and stored at −20 °C at the Tuscia University (Viterbo, Italy) until processing.

Área de Estudo Sandstone rock samples were collected in triplicate in Victoria Land (Continental Antarctica), along a latitudinal transect from 74°10′10.5′′ S 162°25′38.0′′ E (Timber Peak, Northern Victoria Land) to 77°54′43.6′′ S 161°34′39.3′′ E (Finger Mt., Southern Victoria Land) ranging from 834 m a.s.l. (Battleship Promontory, Southern Victoria Land) to 3100 m a.s.l. (Mt. New Zealand, Northern Victoria Land). In addition, rocks with different sun exposures were collected from four visited sites (Battleship Promontory, Siegfried Peak, Finger Mt. and University Valley). All sites were visited during the XXXII Italian Antarctic Expedition (2015–2016).

Descrição dos passos do método:

  1. Rocks were crushed using a Grinder MM 400 RETSCH (Verder Scientific, Bologna, Italy) in sterile conditions to avoid contamination.
  2. Metagenomic DNA was extracted from 0.3 g of rocks using MOBIO Power Soil DNA Extraction kit (MOBIO Laboratories, Carlsbad, CA, USA), according to the manufacturer’s instructions. ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2 (GCTGCGTTCTTCATCGATGC) primers were used to amplify the internal transcribed spacer 1 region (ITS1). PCR reactions were performed in a total volume of 25 μL, containing 1 μL of each primer, 12.5 μL of Taq DNA Polymerase (Thermo Fischer Scientific Inc., Waltham, MA, USA), 9.5 μL of nuclease-free water (Sigma-Aldrich, St. Louis, MO, USA) and 5 ng of DNA, following Coleine et al. PCR conditions were initial denaturation at 93 °C for 3 min, 35 cycles of denaturation at 95 °C for 45 s, annealing at 50 °C for 1 min, extension at 72°C for 90 s, followed by a final extension at 72 °C for 10 min in an automated thermal cycler (BioRad, Hercules, CA, USA). Amplicons, purified with Qiagen PCR CleanUp kit (Macherey-Nagel, Hoerdt, France) and quantified using the Qubit dsDNA HS Assay Kit (Life Technologies, Carlsbad, CA, USA), were tagged with unique barcodes to enable identification of each sample, and then pooled for run sequencing.
  3. Sequencing (paired-end reads, 2 × 300 bp) of the pooled libraries was performed on a single Illumina MiSeq flowcell at the Institute for Integrative Genome Biology, University of California, Riverside.

Citações bibliográficas

  1. Coleine, C., Zucconi, L., Onofri, S., Pombubpa, N., Stajich, J., & Selbmann, L. (2018). Sun Exposure Shapes Functional Grouping of Fungi in Cryptoendolithic Antarctic Communities. Life, 8(2), 19.

Metadados Adicionais

Identificadores alternativos b94f714c-e890-4365-81a5-968a20606d37
https://ipt.biodiversity.aq/resource?r=antarctic_cryptoendolithic_microbial_fungi_its