Antarctic cryptoendolithic fungal communities ITS amplicon sequencing

Metadata-only
Последняя версия опубликовано SCAR - Microbial Antarctic Resource System мар. 19, 2019 SCAR - Microbial Antarctic Resource System
Дата публикации:
19 марта 2019 г.
Опубликовано:
SCAR - Microbial Antarctic Resource System
Лицензия:
CC-BY 4.0

Скачайте последнюю версию метаданных ресурса (только метаданные) в формате EML или RTF:

Метаданные в формате EML Скачать в English (10 KB)
Метаданные в формате RTF Скачать в English (12 KB)

Описание

Amplicon sequencing dataset of cryptoendolithic (sandstone) fungal communities (ITS1 marker gene) in Victoria Land (continental Antarctica).

Версии

В таблице ниже указаны только опубликованные версии ресурса, которые доступны для свободного скачивания.

Как оформить ссылку

Исследователи должны дать ссылку на эту работу следующим образом:

Coleine C, Zucconi L, Onofri S, Pombubpa N, Stajich J, Selbman L (2018): Antarctic cryptoendolithic fungal communities ITS amplicon sequencing. v1.2. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=antarctic_cryptoendolithic_microbial_fungi_its&v=1.2

Права

Исследователи должны соблюдать следующие права:

Публикующей организацией и владельцем прав на данную работу является SCAR - Microbial Antarctic Resource System. Эта работа находится под лицензией Creative Commons Attribution (CC-BY 4.0).

Регистрация в GBIF

Этот ресурс был зарегистрирован в GBIF, ему был присвоен следующий UUID: b94f714c-e890-4365-81a5-968a20606d37.  SCAR - Microbial Antarctic Resource System отвечает за публикацию этого ресурса, и зарегистрирован в GBIF как издатель данных при оподдержке Scientific Committee on Antarctic Research.

Ключевые слова

Metadata

Контакты

Claudia Coleine
  • Originator ●
  • Point Of Contact
University of Tuscia
Viterbo
IT
Laura Zucconi
  • Originator
University of Tuscia
Viterbo
IT
Silvano Onofri
  • Originator
University of Tuscia
Viterbo
IT
Nuttapon Pombubpa
  • Originator
University of California
US
Jason Stajich
  • Originator
University of California
US
Laura Selbman
  • Originator
University of Tuscia
Viterbo
IT
Maxime Sweetlove
  • User
  • Research assistent
Royal Belgian Institute of Natural Sciences
  • Rue Vautier 29
1000 Brussels
Maxime Sweetlove
  • User

Географический охват

Victoria Land (Continental Antarctica)

Ограничивающие координаты Юг Запад [-77,91, 159,233], Север Восток [-74,169, 162,514]

Таксономический охват

microbial fungi (ITS1)

Phylum Fungi (Fungi)

Данные проекта

Описание отсутсвует

Название Antarctic cryptoendolithic fungal communities
Финансирование Sequencing was supported by funds through United States Department of Agriculture—National Institute of Food and Agriculture Hatch project CA-R-PPA-5062-H. Data analyses were performed on the High-Performance Computing Cluster at the University of California-Riverside in the Institute of Integrative Genome Biology supported by NSF DBI-1429826 and NIH S10-OD016290. Additional support was given through a Royal Thai government fellowship.

Исполнители проекта:

Claudia Coleine

Методы сбора

Rock samples were excised aseptically, transported, and stored at −20 °C at the Tuscia University (Viterbo, Italy) until processing.

Охват исследования Sandstone rock samples were collected in triplicate in Victoria Land (Continental Antarctica), along a latitudinal transect from 74°10′10.5′′ S 162°25′38.0′′ E (Timber Peak, Northern Victoria Land) to 77°54′43.6′′ S 161°34′39.3′′ E (Finger Mt., Southern Victoria Land) ranging from 834 m a.s.l. (Battleship Promontory, Southern Victoria Land) to 3100 m a.s.l. (Mt. New Zealand, Northern Victoria Land). In addition, rocks with different sun exposures were collected from four visited sites (Battleship Promontory, Siegfried Peak, Finger Mt. and University Valley). All sites were visited during the XXXII Italian Antarctic Expedition (2015–2016).

Описание этапа методики:

  1. Rocks were crushed using a Grinder MM 400 RETSCH (Verder Scientific, Bologna, Italy) in sterile conditions to avoid contamination.
  2. Metagenomic DNA was extracted from 0.3 g of rocks using MOBIO Power Soil DNA Extraction kit (MOBIO Laboratories, Carlsbad, CA, USA), according to the manufacturer’s instructions. ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2 (GCTGCGTTCTTCATCGATGC) primers were used to amplify the internal transcribed spacer 1 region (ITS1). PCR reactions were performed in a total volume of 25 μL, containing 1 μL of each primer, 12.5 μL of Taq DNA Polymerase (Thermo Fischer Scientific Inc., Waltham, MA, USA), 9.5 μL of nuclease-free water (Sigma-Aldrich, St. Louis, MO, USA) and 5 ng of DNA, following Coleine et al. PCR conditions were initial denaturation at 93 °C for 3 min, 35 cycles of denaturation at 95 °C for 45 s, annealing at 50 °C for 1 min, extension at 72°C for 90 s, followed by a final extension at 72 °C for 10 min in an automated thermal cycler (BioRad, Hercules, CA, USA). Amplicons, purified with Qiagen PCR CleanUp kit (Macherey-Nagel, Hoerdt, France) and quantified using the Qubit dsDNA HS Assay Kit (Life Technologies, Carlsbad, CA, USA), were tagged with unique barcodes to enable identification of each sample, and then pooled for run sequencing.
  3. Sequencing (paired-end reads, 2 × 300 bp) of the pooled libraries was performed on a single Illumina MiSeq flowcell at the Institute for Integrative Genome Biology, University of California, Riverside.

Библиографические ссылки

  1. Coleine, C., Zucconi, L., Onofri, S., Pombubpa, N., Stajich, J., & Selbmann, L. (2018). Sun Exposure Shapes Functional Grouping of Fungi in Cryptoendolithic Antarctic Communities. Life, 8(2), 19.

Дополнительные метаданные

Альтернативные идентификаторы b94f714c-e890-4365-81a5-968a20606d37
https://ipt.biodiversity.aq/resource?r=antarctic_cryptoendolithic_microbial_fungi_its