Associated microbiome (Bacteria and Fungi) in Antarctic sea stars (healthy versus exhibiting epidermal disease)

Versions

Le tableau ci-dessous n'affiche que les versions publiées de la ressource accessibles publiquement.

Comment citer

Les chercheurs doivent citer cette ressource comme suit:

Núñez-Pons L, Work T, Angulo-Preckler C, Moles J, Avila C (2018): Associated microbiome (Bacteria and Fungi) in Antarctic sea stars (healthy versus exhibiting epidermal disease). v1.2. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=associated_microbiome_antarctic_sea_stars&v=1.2

Droits

Les chercheurs doivent respecter la déclaration de droits suivante:

L’éditeur et détenteur des droits de cette ressource est SCAR - Microbial Antarctic Resource System. Ce travail est sous licence Creative Commons Attribution (CC-BY) 4.0.

Enregistrement GBIF

Cette ressource a été enregistrée sur le portail GBIF, et possède l'UUID GBIF suivante : 5400a04a-01ba-46d3-8470-d256219e6a6a.  SCAR - Microbial Antarctic Resource System publie cette ressource, et est enregistré dans le GBIF comme éditeur de données avec l'approbation du Scientific Committee on Antarctic Research.

Mots-clé

Metadata

Contacts

Couverture géographique

Deception island, Antarctica

Couverture taxonomique

microbiome (bacteria (16S ssu rRNA gene) and Fungi (ITS)) associated with Antarctic sea stars (Odontaster validus)

Couverture temporelle

Données sur le projet

Pas de description disponible

Les personnes impliquées dans le projet:

Méthodes d'échantillonnage

Twenty-five healthy and diseased O validus (n = 50) were collected by SCUBA diving on February 2013. Tissue biopsies (1 cm3) were removed with sterile scalpel from 30 individuals (15 healthy and 15 diseased) as follows: 15 sections from healthy specimens, 15 affected lesion fronts from diseased sea stars, and 15 tissue areas several cm away from the lesions of the same diseased specimens. Samples were divided in two subsamples, one preserved in 100% ethanol at −20 °C for DNA extraction and microbial characterization, and the other fixed in 2.5% paraformaldehyde in filtered sea water at 4 °C for histopathology studies.

Description des étapes de la méthode:

1. DNA from healthy and lesioned tissues of healthy and diseased stars were extracted using a modified C-TAB organic extraction protocol for amplicon deep sequencing of ribosomal gene target markers on MiSeq (Illumina), for bacterial/archaeal and fungal community composition, which were performed with a two-PCR protocol and two dual-index strategy. In the first PCR, we used bacterial specific primers to amplify the V3–V4 region of the small-subunit ribosomal RNA (16S) gene (341 F and 785 R); and fungi-specific primers ITS1F41 and ITS2R targeting the internal transcribed spacer 1 (ITS1) region of fungi. Amplifications were performed in 25 µl reactions with NEBNext® Q5® Hot Start HiFi PCR Master Mix (New England Biolabs, Inc.), 0.8 µl BSA (Bovine Serum Albumin; 20 mg/ml), 1 µl of each 5 µM primer, and 1.5 µl of template. Reactions were under the thermocycling profile: 98 °C for 2 min, then 28 cycles of 98 °C for 15 s, 53 °C for 30 s, 72 °C for 30 s, final extension at 72 °C for 2 min. The second Index PCR to attach dual indexes and Illumina sequencing adapters used forward primers with the 5′-3′ Illumina i5 adapter (AATGATACGGCGACCACCGAGATCTACAC), an 8–10 bp barcode and a primer pad; and reverse fusion primers with 5′-3′ Illumina i7 adapter (CAAGCAGAAGACGGCATACGAGAT), an 8–10 bp barcode, a primer pad. Reactions were made in 25 μl with 0.5 µl of each 5 µM primer, and 1 µl of corresponding products from first amplicon PCR reactions diluted (1:30), and with a temperature regime of: 98 °C for 2 min, then 28 cycles of 98 °C for 15 s, 55 °C for 30 s, 72 °C for 30 s, final extension at 72 °C for 2 min. The PCR products were purified and pooled equimolar on Just-a-Plate™ 96 PCR Purification and Normalization Kit plates following manufacturer’s instructions (Charm Biotec).
2. Paired-end sequencing was performed on an Illumina MiSeq sequencer 2 × 300 flow cell at 10 pM at Core Lab, Hawai’i Institute of Marine Biology (Hawai’i, USA).

Citations bibliographiques

1. Núñez-Pons, L., Work, T. M., Angulo-Preckler, C., Moles, J., & Avila, C. (2018). Exploring the pathology of an epidermal disease affecting a circum-Antarctic sea star. Scientific reports, 8(1), 11353.

Métadonnées additionnelles