Associated microbiome (Bacteria and Fungi) in Antarctic sea stars (healthy versus exhibiting epidermal disease)

Versões

A tabela abaixo mostra apenas versões de recursos que são publicamente acessíveis.

Como citar

Pesquisadores deveriam citar esta obra da seguinte maneira:

Núñez-Pons L, Work T, Angulo-Preckler C, Moles J, Avila C (2018): Associated microbiome (Bacteria and Fungi) in Antarctic sea stars (healthy versus exhibiting epidermal disease). v1.2. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=associated_microbiome_antarctic_sea_stars&v=1.2

Direitos

Pesquisadores devem respeitar a seguinte declaração de direitos:

O editor e o detentor dos direitos deste trabalho é SCAR - Microbial Antarctic Resource System. This work is licensed under a Creative Commons Attribution (CC-BY 4.0) License.

GBIF Registration

Este recurso foi registrado no GBIF e atribuído ao seguinte GBIF UUID: 5400a04a-01ba-46d3-8470-d256219e6a6a.  SCAR - Microbial Antarctic Resource System publica este recurso, e está registrado no GBIF como um publicador de dados aprovado por Scientific Committee on Antarctic Research.

Palavras-chave

Metadata

Contatos

Cobertura Geográfica

Deception island, Antarctica

Cobertura Taxonômica

microbiome (bacteria (16S ssu rRNA gene) and Fungi (ITS)) associated with Antarctic sea stars (Odontaster validus)

Cobertura Temporal

Dados Sobre o Projeto

Nenhuma descrição disponível

O pessoal envolvido no projeto:

Métodos de Amostragem

Twenty-five healthy and diseased O validus (n = 50) were collected by SCUBA diving on February 2013. Tissue biopsies (1 cm3) were removed with sterile scalpel from 30 individuals (15 healthy and 15 diseased) as follows: 15 sections from healthy specimens, 15 affected lesion fronts from diseased sea stars, and 15 tissue areas several cm away from the lesions of the same diseased specimens. Samples were divided in two subsamples, one preserved in 100% ethanol at −20 °C for DNA extraction and microbial characterization, and the other fixed in 2.5% paraformaldehyde in filtered sea water at 4 °C for histopathology studies.

Descrição dos passos do método:

1. DNA from healthy and lesioned tissues of healthy and diseased stars were extracted using a modified C-TAB organic extraction protocol for amplicon deep sequencing of ribosomal gene target markers on MiSeq (Illumina), for bacterial/archaeal and fungal community composition, which were performed with a two-PCR protocol and two dual-index strategy. In the first PCR, we used bacterial specific primers to amplify the V3–V4 region of the small-subunit ribosomal RNA (16S) gene (341 F and 785 R); and fungi-specific primers ITS1F41 and ITS2R targeting the internal transcribed spacer 1 (ITS1) region of fungi. Amplifications were performed in 25 µl reactions with NEBNext® Q5® Hot Start HiFi PCR Master Mix (New England Biolabs, Inc.), 0.8 µl BSA (Bovine Serum Albumin; 20 mg/ml), 1 µl of each 5 µM primer, and 1.5 µl of template. Reactions were under the thermocycling profile: 98 °C for 2 min, then 28 cycles of 98 °C for 15 s, 53 °C for 30 s, 72 °C for 30 s, final extension at 72 °C for 2 min. The second Index PCR to attach dual indexes and Illumina sequencing adapters used forward primers with the 5′-3′ Illumina i5 adapter (AATGATACGGCGACCACCGAGATCTACAC), an 8–10 bp barcode and a primer pad; and reverse fusion primers with 5′-3′ Illumina i7 adapter (CAAGCAGAAGACGGCATACGAGAT), an 8–10 bp barcode, a primer pad. Reactions were made in 25 μl with 0.5 µl of each 5 µM primer, and 1 µl of corresponding products from first amplicon PCR reactions diluted (1:30), and with a temperature regime of: 98 °C for 2 min, then 28 cycles of 98 °C for 15 s, 55 °C for 30 s, 72 °C for 30 s, final extension at 72 °C for 2 min. The PCR products were purified and pooled equimolar on Just-a-Plate™ 96 PCR Purification and Normalization Kit plates following manufacturer’s instructions (Charm Biotec).
2. Paired-end sequencing was performed on an Illumina MiSeq sequencer 2 × 300 flow cell at 10 pM at Core Lab, Hawai’i Institute of Marine Biology (Hawai’i, USA).

Citações bibliográficas

1. Núñez-Pons, L., Work, T. M., Angulo-Preckler, C., Moles, J., & Avila, C. (2018). Exploring the pathology of an epidermal disease affecting a circum-Antarctic sea star. Scientific reports, 8(1), 11353.

Metadados Adicionais