Descripción
Amplicon sequencing dataset (Illumina MiSeq) of Bacteria (16S ssu rRNA) in an Antarctic glacial foreland soil gradient
Versiones
La siguiente tabla muestra sólo las versiones publicadas del recurso que son de acceso público.
¿Cómo referenciar?
Los usuarios deben citar este trabajo de la siguiente manera:
Yan W, Ma H, Shi G, Sun B, Xiao X, Zhang Y (2018): Bacteria in Antarctic glacial foreland soils. v1.3. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_glacial_foreland_soils&v=1.3
Derechos
Los usuarios deben respetar los siguientes derechos de uso:
El publicador y propietario de los derechos de este trabajo es SCAR - Microbial Antarctic Resource System. Esta obra está bajo una licencia Creative Commons de Atribución/Reconocimiento (CC-BY 4.0).
Registro GBIF
Este recurso ha sido registrado en GBIF con el siguiente UUID: 8e7cf0b8-4789-4b79-9dc9-33d65ed79918. SCAR - Microbial Antarctic Resource System publica este recurso y está registrado en GBIF como un publicador de datos avalado por Scientific Committee on Antarctic Research.
Palabras clave
Metadata
Contactos
- Originador ●
- Punto De Contacto
- Originador
- Originador
- Originador
- Originador
- Originador
- Proveedor De Los Metadatos
Cobertura geográfica
Soil samples were collected from the glacial foreland in Larsemann Hills in East Antarctica
Coordenadas límite | Latitud Mínima Longitud Mínima [-69, 76,407], Latitud Máxima Longitud Máxima [-69, 76,407] |
---|
Cobertura taxonómica
Bacteria 16S ssu rRNA marker gene, v4 region
Dominio | Bacteria (Bacteria) |
---|
Datos del proyecto
No hay descripción disponible
Título | Bacteria in Antarctic glacial foreland soils |
---|---|
Fuentes de Financiación | Funding was provided by the National Natural Science Foundation of China (grants 41276202, 41476123, 41676177), China Ocean Mineral Resources R&D Association (grants DY125-22-04), and the thirteen Five-Year Plan for Polar Science (grants CHINARE 2016-02-02). |
Personas asociadas al proyecto:
Métodos de muestreo
Surface soil layers, approximately 5 cm, were collected. When sites were covered by ice (3,4 and 5), the covering ice was gently cracked and the ice fractures were removed before sampling the soil beneath. The samples were stored in plastic bags and kept at -20°C during transport and storage in the laboratory until they were used for further analysis.
Área de Estudio | Soil samples were collected from the glacial foreland in Larsemann Hills in East Antarctica (-69.39762S, 76.40666 E), during the 29th Chinese National Antarctic Research Expedition in the Antarctic summer in February 2013. |
---|
Descripción de la metodología paso a paso:
- Each soil sample was homogenized and sub-sampled for DNA extraction and geochemical measurements.
- An SDS-based method was employed to extract the DNA from soil (Natarajan et al., 2016). The bacterial V4 region of the 16S rRNA gene was amplified with a special bacterial primer pair 533F (TGCCAGCAGCCGCGGTAA)/Bact806R (GGACTACCAGGGTATCTAATCCTGTT). A sample tagging approach was employed, and a different barcode was added before the forward primer for each sample. The PCR reagents were mixed as follow: 5 μl of 10× Taq buffer (Takara, Otsu, Shiga, Japan), 4 μl of dNTP (Takara, Otsu, Shiga, Japan), 1 μl of each primer (10 μM stored concentration), 0.25 μl of Ex Taq DNA polymerase (Takara, Otsu, Shiga, Japan), approximately 50 ng of DNA, 2.5 μl of BSA (Bull Serum Albumin), and 32.75 μl of water. The PCR amplification consisted of an initial denaturation at 94°C for 5 min; 25 cycles of denaturation at 94°C for 40 s, annealing at 58°C for 40 s, and extension at 72°C for 1 min; and a final extension at 72°C for 8 min. The PCR products were purified with a Gel Extraction Kit (Omega Bio-Tek, Norcross, GA, United States) according to the manufacturer’s instructions.
- The reads were obtained with MiSeq sequencing platform (Illumina, San Diego, CA, United States).
Referencias bibliográficas
- Yan, W., Ma, H., Shi, G., Li, Y., Sun, B., Xiao, X., & Zhang, Y. (2017). Independent Shifts of Abundant and Rare Bacterial Populations across East Antarctica Glacial Foreland. Frontiers in microbiology, 8, 1534.
Metadatos adicionales
Identificadores alternativos | 8e7cf0b8-4789-4b79-9dc9-33d65ed79918 |
---|---|
https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_glacial_foreland_soils |