Bacteria in Antarctic glacial foreland soils

Versions

Le tableau ci-dessous n'affiche que les versions publiées de la ressource accessibles publiquement.

Comment citer

Les chercheurs doivent citer cette ressource comme suit:

Yan W, Ma H, Shi G, Sun B, Xiao X, Zhang Y (2018): Bacteria in Antarctic glacial foreland soils. v1.3. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_glacial_foreland_soils&v=1.3

Droits

Les chercheurs doivent respecter la déclaration de droits suivante:

L’éditeur et détenteur des droits de cette ressource est SCAR - Microbial Antarctic Resource System. Ce travail est sous licence Creative Commons Attribution (CC-BY) 4.0.

Enregistrement GBIF

Cette ressource a été enregistrée sur le portail GBIF, et possède l'UUID GBIF suivante : 8e7cf0b8-4789-4b79-9dc9-33d65ed79918.  SCAR - Microbial Antarctic Resource System publie cette ressource, et est enregistré dans le GBIF comme éditeur de données avec l'approbation du Scientific Committee on Antarctic Research.

Mots-clé

Metadata

Contacts

Couverture géographique

Soil samples were collected from the glacial foreland in Larsemann Hills in East Antarctica

Couverture taxonomique

Bacteria 16S ssu rRNA marker gene, v4 region

Données sur le projet

Pas de description disponible

Les personnes impliquées dans le projet:

Méthodes d'échantillonnage

Surface soil layers, approximately 5 cm, were collected. When sites were covered by ice (3,4 and 5), the covering ice was gently cracked and the ice fractures were removed before sampling the soil beneath. The samples were stored in plastic bags and kept at -20°C during transport and storage in the laboratory until they were used for further analysis.

Description des étapes de la méthode:

1. Each soil sample was homogenized and sub-sampled for DNA extraction and geochemical measurements.
2. An SDS-based method was employed to extract the DNA from soil (Natarajan et al., 2016). The bacterial V4 region of the 16S rRNA gene was amplified with a special bacterial primer pair 533F (TGCCAGCAGCCGCGGTAA)/Bact806R (GGACTACCAGGGTATCTAATCCTGTT). A sample tagging approach was employed, and a different barcode was added before the forward primer for each sample. The PCR reagents were mixed as follow: 5 μl of 10× Taq buffer (Takara, Otsu, Shiga, Japan), 4 μl of dNTP (Takara, Otsu, Shiga, Japan), 1 μl of each primer (10 μM stored concentration), 0.25 μl of Ex Taq DNA polymerase (Takara, Otsu, Shiga, Japan), approximately 50 ng of DNA, 2.5 μl of BSA (Bull Serum Albumin), and 32.75 μl of water. The PCR amplification consisted of an initial denaturation at 94°C for 5 min; 25 cycles of denaturation at 94°C for 40 s, annealing at 58°C for 40 s, and extension at 72°C for 1 min; and a final extension at 72°C for 8 min. The PCR products were purified with a Gel Extraction Kit (Omega Bio-Tek, Norcross, GA, United States) according to the manufacturer’s instructions.
3. The reads were obtained with MiSeq sequencing platform (Illumina, San Diego, CA, United States).

Citations bibliographiques

1. Yan, W., Ma, H., Shi, G., Li, Y., Sun, B., Xiao, X., & Zhang, Y. (2017). Independent Shifts of Abundant and Rare Bacterial Populations across East Antarctica Glacial Foreland. Frontiers in microbiology, 8, 1534.

Métadonnées additionnelles