Metadata-only

Bacteria in Antarctic glacial foreland soils

Последняя версия опубликована SCAR - Microbial Antarctic Resource System 19 марта 2019 г. SCAR - Microbial Antarctic Resource System
Дата публикации:
19 марта 2019 г.
Лицензия:
CC-BY 4.0

Скачайте последнюю версию метаданных ресурса (только метаданные) в формате EML или RTF:

Метаданные в формате EML Скачать в English (9 KB)
Метаданные в формате RTF Скачать в English (11 KB)

Описание

Amplicon sequencing dataset (Illumina MiSeq) of Bacteria (16S ssu rRNA) in an Antarctic glacial foreland soil gradient

Версии

В таблице ниже указаны только опубликованные версии ресурса, которые доступны для свободного скачивания.

Как оформить ссылку

Исследователи должны дать ссылку на эту работу следующим образом:

Yan W, Ma H, Shi G, Sun B, Xiao X, Zhang Y (2018): Bacteria in Antarctic glacial foreland soils. v1.3. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_glacial_foreland_soils&v=1.3

Права

Исследователи должны соблюдать следующие права:

Публикующей организацией и владельцем прав на данную работу является SCAR - Microbial Antarctic Resource System. This work is licensed under a Creative Commons Attribution (CC-BY) 4.0 License.

Регистрация в GBIF

Этот ресурс был зарегистрирован в GBIF, ему был присвоен следующий UUID: 8e7cf0b8-4789-4b79-9dc9-33d65ed79918.  SCAR - Microbial Antarctic Resource System отвечает за публикацию этого ресурса, и зарегистрирован в GBIF как издатель данных при оподдержке Scientific Committee on Antarctic Research.

Ключевые слова

Metadata

Контакты

Кто является создателем ресурса:
-

Wenkai Yan
Shanghai Jiao Tong University
Shanghai
CN
Hongmei Ma
Polar Research Institute of China
Shanghai
CN
Guitao Shi
Polar Research Institute of China
Shanghai
CN
Bo Sun
Polar Research Institute of China
Shanghai
CN
Xiang Xiao
Shanghai Jiao Tong University
Shanghai
CN
Yu Zhang
Shanghai Jiao Tong University
Shanghai
CN

Кто может ответить на вопросы о ресурсе:

Wenkai Yan
Shanghai Jiao Tong University
Shanghai
CN

Кем заполнены метаданные:
-

Maxime Sweetlove
Research assistent
Royal Belgian Institute for Natural Sciences
Rue Vautier 29
1000 Brussels
BE

Кто еще связан с данным ресурсом:

User

Географический охват

Soil samples were collected from the glacial foreland in Larsemann Hills in East Antarctica

Ограничивающие координаты Юг Запад [-69, 76,407], Север Восток [-69, 76,407]

Таксономический охват

Bacteria 16S ssu rRNA marker gene, v4 region

Domain Bacteria (Bacteria)

Данные проекта

Описание отсутсвует

Название Bacteria in Antarctic glacial foreland soils
Финансирование Funding was provided by the National Natural Science Foundation of China (grants 41276202, 41476123, 41676177), China Ocean Mineral Resources R&D Association (grants DY125-22-04), and the thirteen Five-Year Plan for Polar Science (grants CHINARE 2016-02-02).

Исполнители проекта:

Wenkai Yan

Методы сбора

Surface soil layers, approximately 5 cm, were collected. When sites were covered by ice (3,4 and 5), the covering ice was gently cracked and the ice fractures were removed before sampling the soil beneath. The samples were stored in plastic bags and kept at -20°C during transport and storage in the laboratory until they were used for further analysis.

Охват исследования Soil samples were collected from the glacial foreland in Larsemann Hills in East Antarctica (-69.39762S, 76.40666 E), during the 29th Chinese National Antarctic Research Expedition in the Antarctic summer in February 2013.

Описание этапа методики:

  1. Each soil sample was homogenized and sub-sampled for DNA extraction and geochemical measurements.
  2. An SDS-based method was employed to extract the DNA from soil (Natarajan et al., 2016). The bacterial V4 region of the 16S rRNA gene was amplified with a special bacterial primer pair 533F (TGCCAGCAGCCGCGGTAA)/Bact806R (GGACTACCAGGGTATCTAATCCTGTT). A sample tagging approach was employed, and a different barcode was added before the forward primer for each sample. The PCR reagents were mixed as follow: 5 μl of 10× Taq buffer (Takara, Otsu, Shiga, Japan), 4 μl of dNTP (Takara, Otsu, Shiga, Japan), 1 μl of each primer (10 μM stored concentration), 0.25 μl of Ex Taq DNA polymerase (Takara, Otsu, Shiga, Japan), approximately 50 ng of DNA, 2.5 μl of BSA (Bull Serum Albumin), and 32.75 μl of water. The PCR amplification consisted of an initial denaturation at 94°C for 5 min; 25 cycles of denaturation at 94°C for 40 s, annealing at 58°C for 40 s, and extension at 72°C for 1 min; and a final extension at 72°C for 8 min. The PCR products were purified with a Gel Extraction Kit (Omega Bio-Tek, Norcross, GA, United States) according to the manufacturer’s instructions.
  3. The reads were obtained with MiSeq sequencing platform (Illumina, San Diego, CA, United States).

Библиографические ссылки

  1. Yan, W., Ma, H., Shi, G., Li, Y., Sun, B., Xiao, X., & Zhang, Y. (2017). Independent Shifts of Abundant and Rare Bacterial Populations across East Antarctica Glacial Foreland. Frontiers in microbiology, 8, 1534.

Дополнительные метаданные

Альтернативные идентификаторы 8e7cf0b8-4789-4b79-9dc9-33d65ed79918
https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_glacial_foreland_soils