Solamente metadatos

Bacteria (16S ssu rRNA) in an Antarctic snow sample

Última versión Publicado por SCAR - Microbial Antarctic Resource System en 19 de marzo de 2019 SCAR - Microbial Antarctic Resource System
Fecha de publicación:
19 de marzo de 2019
Licencia:
CC-BY 4.0

Descargue la última versión de los metadatos como EML o RTF:

Metadatos como un archivo EML descargar en Inglés (12 KB)
Metadatos como un archivo RTF descargar en Inglés (13 KB)

Descripción

Amplicon sequencing sample of Bacteria (16S ssu rRNA gene, v1-v3 region) from a snow sample taken from the "clean Area”, 2 km South from the Antarctic Research Base “Concordia” (75°06′S–123°20′E).

Versiones

La siguiente tabla muestra sólo las versiones publicadas del recurso que son de acceso público.

¿Cómo referenciar?

Los usuarios deben citar este trabajo de la siguiente manera:

Michaud L, Lo Giudice A, Mysara M, Monsieurs P, Raffa C, Leys N, Almafitano S, Van Houdt R (2019): Bacteria (16S ssu rRNA) in an Antarctic snow sample. v1.2. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_snow&v=1.2

Derechos

Los usuarios deben respetar los siguientes derechos de uso:

El publicador y propietario de los derechos de este trabajo es SCAR - Microbial Antarctic Resource System. Este trabajo está autorizado bajo una Licencia Creative Commons Atribución/Reconocimiento 4.0 Internacional (CC-BY) 4.0.

Registro GBIF

Este recurso ha sido registrado en GBIF con el siguiente UUID: 647cb838-3294-4ee3-8ebc-a3a0075c7e5a.  SCAR - Microbial Antarctic Resource System publica este recurso y está registrado en GBIF como un publicador de datos avalado por Scientific Committee on Antarctic Research.

Palabras clave

Metadata

Contactos

¿Quién creó el recurso?:
-

Luigi Michaud
University of Messina
Messina
IT
Angelina Lo Giudice
University of Messina
Messina
IT
Mohamed Mysara
Vrije Universiteit Brussel
Brussels
BE
Pieter Monsieurs
Belgian Nuclear Research Centre (SCK CEN)
Mol
BE
Carmella Raffa
University of Messina
Messina
IT
Natalie Leys
Belgian Nuclear Research Centre (SCK CEN)
Mol
BE
Stefano Almafitano
National Research Council (IRSA-CNR)
Rome
IT
Rob Van Houdt
Belgian Nuclear Research Centre (SCK CEN)
Mol
BE

¿Quién puede resolver dudas acerca del recurso?:

Luigi Michaud
University of Messina
Messina
IT
Angelina Lo Giudice
University of Messina
Messina
IT

¿Quién documentó los metadatos?:
-

Maxime Sweetlove
Research assistent
Royal Belgian Institute for Natural Sciences
Rue Vautier 29
Brussels

¿Quién más está asociado con el recurso?:

Usuario

Cobertura geográfica

Antarctic snow surface sample collected in the “Clean Area” 2 km South from the Research Base “Concordia” (75°06′S–123°20′E)

Coordenadas límite Latitud Mínima Longitud Mínima [-75, -123], Latitud Máxima Longitud Máxima [-75, -123]

Cobertura taxonómica

Bacteria (16S ssu rRNA gene, v1-v3 region)

Dominio Bacteria (Bacteria)

Cobertura temporal

Fecha Inicial 2010-01-01

Datos del proyecto

No hay descripción disponible

Título Bacteria (16S ssu rRNA) in an Antarctic snow sample
Fuentes de Financiación Support was given by the Italian “Programma Nazionale di Richerche in Antartide” (PNRA) and the MNA (Museo Nazionale dell'Antartide)

Personas asociadas al proyecto:

Luigi Michaud
Angelina Lo Giudice

Métodos de muestreo

Sampling was performed by using polyethylene boxes pre-treated with 1M hydrogen chloride and hydrogen peroxide. Sterile gloves and suit, and an ethanol flame-sterilized shovel were used.

Área de Estudio Snow surface sample was collected in triplicate from a “Clean Area” 2 km from the Research Base “Concordia” (75°06′S–123°20′E)
Control de Calidad Autoclave-sterilized Milli-Q water was treated in tandem with the snow samples as a negative-control field blank. Quantity and quality of extracted DNA was checked by nanodrop ND-1000 device and the Quant-iT PicoGreen dsDNA reagent and kit (Life Tech, Carlsbad, USA) following the manufacturer's instructions.

Descripción de la metodología paso a paso:

  1. Collected samples were allowed to thaw at 4°C for 24–48 h in the laboratory, with 100 litres of packed snow per sample resulting in approximately 20 litres of snowmelt.
  2. 15 L melted snow for DNA extraction was filtered through a 0.2-µm-pore-size Sterivex filter unit (Millipore). The filters were stored at −20°C in lysis buffer (50 mM tris, 40 mM EDTA, and 750 mM sucrose).
  3. Genomic DNA was extracted in triplicate using the phenol-chloroform method according to Zhou et al., and precipitated by adding 0.7 volumes of 100% isopropanol followed by a wash with ice-cold 70% ethanol. After air-drying, DNA was resuspended in 50 µl of deionizated sterile water.
  4. PCR of a bacterial 16S rRNA gene fragment (V1–V3 region, 507 bp) and subsequent tag-encoded pyrosequencing were performed at DNAVision (Charleroi, Belgium). The 16S rRNA genes were amplified using the two universal primers 8F (5′- AGAGTTTGATCCTGGCTCAG -3′) and 518R (5′- ATTACCGCGGCTGCTGG -3′). The forward primer contained the sequence of the Titanium A adaptor (5′-CCATCTCATCCCTGCGTGTCTCCGACTCAG-3′) and a barcode sequence. For each sample, a PCR mix of 100 µl was prepared containing 1×PCR buffer, 2U of KAPA HiFi Hotstart polymerase blend and dNTPs (Kapabiosystems), 300 nM primers (Eurogentec, Liege, Belgium), and 60 ng gDNA. Thermal cycling consisted of initial denaturation at 95°C for 5 min, followed by 25 cycles of denaturation at 98°C for 20 s, annealing at 56°C for 40 s, and extension at 72°C for 20 s, with a final extension of 5 min at 72°C. 3 µl of PCR product were added to a new PCR mix (identical as first round of PCR) for the nested PCR of 15 cycles. Amplicons were visualized on 1% agarose gels using GelGreen Nucleic Acid gel stain in 1× TAE (Biotium) and were cleaned using the Wizard SV Gel and PCR Clean-up System (Promega) according to the manufacturer's instructions. Pyrosequencing was carried out using the forward primer on a 454 Life Sciences Genome Sequencer FLX instrument (Roche) following titanium chemistry.

Referencias bibliográficas

  1. Michaud, L., Giudice, A. L., Mysara, M., Monsieurs, P., Raffa, C., Leys, N., ... & Van Houdt, R. (2014). Snow surface microbiome on the High Antarctic Plateau (DOME C). PloS one, 9(8), e104505.

Metadatos adicionales

Identificadores alternativos 647cb838-3294-4ee3-8ebc-a3a0075c7e5a
https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_snow