Bacteria (16S ssu rRNA) in an Antarctic snow sample

Versões

A tabela abaixo mostra apenas versões de recursos que são publicamente acessíveis.

Como citar

Pesquisadores deveriam citar esta obra da seguinte maneira:

Michaud L, Lo Giudice A, Mysara M, Monsieurs P, Raffa C, Leys N, Almafitano S, Van Houdt R (2019): Bacteria (16S ssu rRNA) in an Antarctic snow sample. v1.2. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_snow&v=1.2

Direitos

Pesquisadores devem respeitar a seguinte declaração de direitos:

O editor e o detentor dos direitos deste trabalho é SCAR - Microbial Antarctic Resource System. This work is licensed under a Creative Commons Attribution (CC-BY 4.0) License.

GBIF Registration

Este recurso foi registrado no GBIF e atribuído ao seguinte GBIF UUID: 647cb838-3294-4ee3-8ebc-a3a0075c7e5a.  SCAR - Microbial Antarctic Resource System publica este recurso, e está registrado no GBIF como um publicador de dados aprovado por Scientific Committee on Antarctic Research.

Palavras-chave

Metadata

Contatos

Cobertura Geográfica

Antarctic snow surface sample collected in the “Clean Area” 2 km South from the Research Base “Concordia” (75°06′S–123°20′E)

Cobertura Taxonômica

Bacteria (16S ssu rRNA gene, v1-v3 region)

Cobertura Temporal

Dados Sobre o Projeto

Nenhuma descrição disponível

O pessoal envolvido no projeto:

Métodos de Amostragem

Sampling was performed by using polyethylene boxes pre-treated with 1M hydrogen chloride and hydrogen peroxide. Sterile gloves and suit, and an ethanol flame-sterilized shovel were used.

Descrição dos passos do método:

1. Collected samples were allowed to thaw at 4°C for 24–48 h in the laboratory, with 100 litres of packed snow per sample resulting in approximately 20 litres of snowmelt.
2. 15 L melted snow for DNA extraction was filtered through a 0.2-µm-pore-size Sterivex filter unit (Millipore). The filters were stored at −20°C in lysis buffer (50 mM tris, 40 mM EDTA, and 750 mM sucrose).
3. Genomic DNA was extracted in triplicate using the phenol-chloroform method according to Zhou et al., and precipitated by adding 0.7 volumes of 100% isopropanol followed by a wash with ice-cold 70% ethanol. After air-drying, DNA was resuspended in 50 µl of deionizated sterile water.
4. PCR of a bacterial 16S rRNA gene fragment (V1–V3 region, 507 bp) and subsequent tag-encoded pyrosequencing were performed at DNAVision (Charleroi, Belgium). The 16S rRNA genes were amplified using the two universal primers 8F (5′- AGAGTTTGATCCTGGCTCAG -3′) and 518R (5′- ATTACCGCGGCTGCTGG -3′). The forward primer contained the sequence of the Titanium A adaptor (5′-CCATCTCATCCCTGCGTGTCTCCGACTCAG-3′) and a barcode sequence. For each sample, a PCR mix of 100 µl was prepared containing 1×PCR buffer, 2U of KAPA HiFi Hotstart polymerase blend and dNTPs (Kapabiosystems), 300 nM primers (Eurogentec, Liege, Belgium), and 60 ng gDNA. Thermal cycling consisted of initial denaturation at 95°C for 5 min, followed by 25 cycles of denaturation at 98°C for 20 s, annealing at 56°C for 40 s, and extension at 72°C for 20 s, with a final extension of 5 min at 72°C. 3 µl of PCR product were added to a new PCR mix (identical as first round of PCR) for the nested PCR of 15 cycles. Amplicons were visualized on 1% agarose gels using GelGreen Nucleic Acid gel stain in 1× TAE (Biotium) and were cleaned using the Wizard SV Gel and PCR Clean-up System (Promega) according to the manufacturer's instructions. Pyrosequencing was carried out using the forward primer on a 454 Life Sciences Genome Sequencer FLX instrument (Roche) following titanium chemistry.

Citações bibliográficas

1. Michaud, L., Giudice, A. L., Mysara, M., Monsieurs, P., Raffa, C., Leys, N., ... & Van Houdt, R. (2014). Snow surface microbiome on the High Antarctic Plateau (DOME C). PloS one, 9(8), e104505.

Metadados Adicionais