Bacteria (16S ssu rRNA) in an Antarctic snow sample
Latest version published by SCAR - Microbial Antarctic Resource System on 19 March 2019 SCAR - Microbial Antarctic Resource System

Amplicon sequencing sample of Bacteria (16S ssu rRNA gene, v1-v3 region) from a snow sample taken from the "clean Area”, 2 km South from the Antarctic Research Base “Concordia” (75°06′S–123°20′E).

GBIF EML RTF Versions Rights Cite this

Download the latest version of the metadata-only resource metadata as EML or RTF:

Metadata as an EML file download in English (12 kB)
Metadata as an RTF file download in English (13 kB)

The table below shows only published versions of the resource that are publicly accessible.

How to cite

Researchers should cite this work as follows:

Michaud L, Lo Giudice A, Mysara M, Monsieurs P, Raffa C, Leys N, Almafitano S, Van Houdt R (2019): Bacteria (16S ssu rRNA) in an Antarctic snow sample. v1.2. SCAR - Microbial Antarctic Resource System. Dataset/Metadata.


Researchers should respect the following rights statement:

The publisher and rights holder of this work is SCAR - Microbial Antarctic Resource System. This work is licensed under a Creative Commons Attribution (CC-BY) 4.0 License.

GBIF Registration

This resource has been registered with GBIF, and assigned the following GBIF UUID: 647cb838-3294-4ee3-8ebc-a3a0075c7e5a.  SCAR - Microbial Antarctic Resource System publishes this resource, and is itself registered in GBIF as a data publisher endorsed by Scientific Committee on Antarctic Research.




Who created the resource:

Luigi Michaud
University of Messina
Angelina Lo Giudice
University of Messina
Mohamed Mysara
Vrije Universiteit Brussel
Pieter Monsieurs
Belgian Nuclear Research Centre (SCK CEN)
Carmella Raffa
University of Messina
Natalie Leys
Belgian Nuclear Research Centre (SCK CEN)
Stefano Almafitano
National Research Council (IRSA-CNR)
Rob Van Houdt
Belgian Nuclear Research Centre (SCK CEN)

Who can answer questions about the resource:

Luigi Michaud
University of Messina
Angelina Lo Giudice
University of Messina

Who filled in the metadata:

Maxime Sweetlove
Research assistent
Royal Belgian Institute for Natural Sciences
Rue Vautier 29

Who else was associated with the resource:

Geographic Coverage

Antarctic snow surface sample collected in the “Clean Area” 2 km South from the Research Base “Concordia” (75°06′S–123°20′E)

Bounding Coordinates South West [-75, -123], North East [-75, -123]
Taxonomic Coverage

Bacteria (16S ssu rRNA gene, v1-v3 region)

Domain  Bacteria (Bacteria)
Temporal Coverage
Start Date 2010-01-01
Project Data

No Description available

Title Bacteria (16S ssu rRNA) in an Antarctic snow sample
Funding Support was given by the Italian “Programma Nazionale di Richerche in Antartide” (PNRA) and the MNA (Museo Nazionale dell'Antartide)

The personnel involved in the project:

Luigi Michaud
Angelina Lo Giudice
Sampling Methods

Sampling was performed by using polyethylene boxes pre-treated with 1M hydrogen chloride and hydrogen peroxide. Sterile gloves and suit, and an ethanol flame-sterilized shovel were used.

Study Extent Snow surface sample was collected in triplicate from a “Clean Area” 2 km from the Research Base “Concordia” (75°06′S–123°20′E)
Quality Control Autoclave-sterilized Milli-Q water was treated in tandem with the snow samples as a negative-control field blank. Quantity and quality of extracted DNA was checked by nanodrop ND-1000 device and the Quant-iT PicoGreen dsDNA reagent and kit (Life Tech, Carlsbad, USA) following the manufacturer's instructions.

Method step description:

  1. Collected samples were allowed to thaw at 4°C for 24–48 h in the laboratory, with 100 litres of packed snow per sample resulting in approximately 20 litres of snowmelt.
  2. 15 L melted snow for DNA extraction was filtered through a 0.2-µm-pore-size Sterivex filter unit (Millipore). The filters were stored at −20°C in lysis buffer (50 mM tris, 40 mM EDTA, and 750 mM sucrose).
  3. Genomic DNA was extracted in triplicate using the phenol-chloroform method according to Zhou et al., and precipitated by adding 0.7 volumes of 100% isopropanol followed by a wash with ice-cold 70% ethanol. After air-drying, DNA was resuspended in 50 µl of deionizated sterile water.
  4. PCR of a bacterial 16S rRNA gene fragment (V1–V3 region, 507 bp) and subsequent tag-encoded pyrosequencing were performed at DNAVision (Charleroi, Belgium). The 16S rRNA genes were amplified using the two universal primers 8F (5′- AGAGTTTGATCCTGGCTCAG -3′) and 518R (5′- ATTACCGCGGCTGCTGG -3′). The forward primer contained the sequence of the Titanium A adaptor (5′-CCATCTCATCCCTGCGTGTCTCCGACTCAG-3′) and a barcode sequence. For each sample, a PCR mix of 100 µl was prepared containing 1×PCR buffer, 2U of KAPA HiFi Hotstart polymerase blend and dNTPs (Kapabiosystems), 300 nM primers (Eurogentec, Liege, Belgium), and 60 ng gDNA. Thermal cycling consisted of initial denaturation at 95°C for 5 min, followed by 25 cycles of denaturation at 98°C for 20 s, annealing at 56°C for 40 s, and extension at 72°C for 20 s, with a final extension of 5 min at 72°C. 3 µl of PCR product were added to a new PCR mix (identical as first round of PCR) for the nested PCR of 15 cycles. Amplicons were visualized on 1% agarose gels using GelGreen Nucleic Acid gel stain in 1× TAE (Biotium) and were cleaned using the Wizard SV Gel and PCR Clean-up System (Promega) according to the manufacturer's instructions. Pyrosequencing was carried out using the forward primer on a 454 Life Sciences Genome Sequencer FLX instrument (Roche) following titanium chemistry.
Bibliographic Citations
  1. Michaud, L., Giudice, A. L., Mysara, M., Monsieurs, P., Raffa, C., Leys, N., ... & Van Houdt, R. (2014). Snow surface microbiome on the High Antarctic Plateau (DOME C). PloS one, 9(8), e104505.
Additional Metadata
Alternative Identifiers 647cb838-3294-4ee3-8ebc-a3a0075c7e5a