Bacteria (16S ssu rRNA) in an Antarctic snow sample

Latest version published by SCAR - Microbial Antarctic Resource System on Mar 19, 2019 SCAR - Microbial Antarctic Resource System
Publication date:
19 March 2019
License:
CC-BY 4.0

Download the latest version of the metadata-only resource metadata as EML or RTF:

Metadata as an EML file download in English (12 KB)
Metadata as an RTF file download in English (13 KB)

Description

Amplicon sequencing sample of Bacteria (16S ssu rRNA gene, v1-v3 region) from a snow sample taken from the "clean Area”, 2 km South from the Antarctic Research Base “Concordia” (75°06′S–123°20′E).

Versions

The table below shows only published versions of the resource that are publicly accessible.

How to cite

Researchers should cite this work as follows:

Michaud L, Lo Giudice A, Mysara M, Monsieurs P, Raffa C, Leys N, Almafitano S, Van Houdt R (2019): Bacteria (16S ssu rRNA) in an Antarctic snow sample. v1.2. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_snow&v=1.2

Rights

Researchers should respect the following rights statement:

The publisher and rights holder of this work is SCAR - Microbial Antarctic Resource System. This work is licensed under a Creative Commons Attribution (CC-BY 4.0) License.

GBIF Registration

This resource has been registered with GBIF, and assigned the following GBIF UUID: 647cb838-3294-4ee3-8ebc-a3a0075c7e5a.  SCAR - Microbial Antarctic Resource System publishes this resource, and is itself registered in GBIF as a data publisher endorsed by Scientific Committee on Antarctic Research.

Keywords

Metadata

Contacts

Luigi Michaud
  • Originator
  • Point Of Contact
University of Messina
Messina
IT
Angelina Lo Giudice
  • Originator
  • Point Of Contact
University of Messina
Messina
IT
Mohamed Mysara
  • Originator
Vrije Universiteit Brussel
Brussels
BE
Pieter Monsieurs
  • Originator
Belgian Nuclear Research Centre (SCK CEN)
Mol
BE
Carmella Raffa
  • Originator
University of Messina
Messina
IT
Natalie Leys
  • Originator
Belgian Nuclear Research Centre (SCK CEN)
Mol
BE
Stefano Almafitano
  • Originator
National Research Council (IRSA-CNR)
Rome
IT
Rob Van Houdt
  • Originator
Belgian Nuclear Research Centre (SCK CEN)
Mol
BE
Maxime Sweetlove
  • Metadata Provider
  • Research assistent
Royal Belgian Institute for Natural Sciences
  • Rue Vautier 29
Brussels

Geographic Coverage

Antarctic snow surface sample collected in the “Clean Area” 2 km South from the Research Base “Concordia” (75°06′S–123°20′E)

Bounding Coordinates South West [-75, -123], North East [-75, -123]

Taxonomic Coverage

Bacteria (16S ssu rRNA gene, v1-v3 region)

Domain Bacteria (Bacteria)

Temporal Coverage

Start Date 2010-01-01

Project Data

No Description available

Title Bacteria (16S ssu rRNA) in an Antarctic snow sample
Funding Support was given by the Italian “Programma Nazionale di Richerche in Antartide” (PNRA) and the MNA (Museo Nazionale dell'Antartide)

The personnel involved in the project:

Luigi Michaud
Angelina Lo Giudice

Sampling Methods

Sampling was performed by using polyethylene boxes pre-treated with 1M hydrogen chloride and hydrogen peroxide. Sterile gloves and suit, and an ethanol flame-sterilized shovel were used.

Study Extent Snow surface sample was collected in triplicate from a “Clean Area” 2 km from the Research Base “Concordia” (75°06′S–123°20′E)
Quality Control Autoclave-sterilized Milli-Q water was treated in tandem with the snow samples as a negative-control field blank. Quantity and quality of extracted DNA was checked by nanodrop ND-1000 device and the Quant-iT PicoGreen dsDNA reagent and kit (Life Tech, Carlsbad, USA) following the manufacturer's instructions.

Method step description:

  1. Collected samples were allowed to thaw at 4°C for 24–48 h in the laboratory, with 100 litres of packed snow per sample resulting in approximately 20 litres of snowmelt.
  2. 15 L melted snow for DNA extraction was filtered through a 0.2-µm-pore-size Sterivex filter unit (Millipore). The filters were stored at −20°C in lysis buffer (50 mM tris, 40 mM EDTA, and 750 mM sucrose).
  3. Genomic DNA was extracted in triplicate using the phenol-chloroform method according to Zhou et al., and precipitated by adding 0.7 volumes of 100% isopropanol followed by a wash with ice-cold 70% ethanol. After air-drying, DNA was resuspended in 50 µl of deionizated sterile water.
  4. PCR of a bacterial 16S rRNA gene fragment (V1–V3 region, 507 bp) and subsequent tag-encoded pyrosequencing were performed at DNAVision (Charleroi, Belgium). The 16S rRNA genes were amplified using the two universal primers 8F (5′- AGAGTTTGATCCTGGCTCAG -3′) and 518R (5′- ATTACCGCGGCTGCTGG -3′). The forward primer contained the sequence of the Titanium A adaptor (5′-CCATCTCATCCCTGCGTGTCTCCGACTCAG-3′) and a barcode sequence. For each sample, a PCR mix of 100 µl was prepared containing 1×PCR buffer, 2U of KAPA HiFi Hotstart polymerase blend and dNTPs (Kapabiosystems), 300 nM primers (Eurogentec, Liege, Belgium), and 60 ng gDNA. Thermal cycling consisted of initial denaturation at 95°C for 5 min, followed by 25 cycles of denaturation at 98°C for 20 s, annealing at 56°C for 40 s, and extension at 72°C for 20 s, with a final extension of 5 min at 72°C. 3 µl of PCR product were added to a new PCR mix (identical as first round of PCR) for the nested PCR of 15 cycles. Amplicons were visualized on 1% agarose gels using GelGreen Nucleic Acid gel stain in 1× TAE (Biotium) and were cleaned using the Wizard SV Gel and PCR Clean-up System (Promega) according to the manufacturer's instructions. Pyrosequencing was carried out using the forward primer on a 454 Life Sciences Genome Sequencer FLX instrument (Roche) following titanium chemistry.

Bibliographic Citations

  1. Michaud, L., Giudice, A. L., Mysara, M., Monsieurs, P., Raffa, C., Leys, N., ... & Van Houdt, R. (2014). Snow surface microbiome on the High Antarctic Plateau (DOME C). PloS one, 9(8), e104505.

Additional Metadata

Alternative Identifiers 647cb838-3294-4ee3-8ebc-a3a0075c7e5a
https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_snow