Bacteria (16S) in Antarctic terrestrial soils of the Sor Rondane Mountains

Versión 1.3 publicado por SCAR - Microbial Antarctic Resource System el nov 19, 2018 SCAR - Microbial Antarctic Resource System
Fecha de publicación:
19 de noviembre de 2018
Licencia:
CC-BY 4.0

Descargue la última versión de los metadatos como EML o RTF:

Metadatos como un archivo EML descargar en Inglés (11 KB)
Metadatos como un archivo RTF descargar en Inglés (8 KB)

Descripción

Illumina sequencing data of bacterial communities in 52 soil samples from the western Sør Rondane Mountains (Dronning Maud Land, East Antarctica).The samples were taken along broad environmental gradients, including different types of bedrock, in an area covering nearly 1000 km2.

Versiones

La siguiente tabla muestra sólo las versiones publicadas del recurso que son de acceso público.

¿Cómo referenciar?

Por favor, tenga en cuenta que ésta es una versión antigua del conjunto de datos.  Los usuarios deben citar este trabajo de la siguiente manera:

Tytgat B, Vyverman W, Willems A, Verleyen E (2018): Bacteria (16S) in Antarctic terrestrial soils of the Sor Rondane Mountains. v1.3. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. http://ipt.biodiversity.aq/resource?r=bacteria_antarctic_terrestrial_soils&v=1.3

Derechos

Los usuarios deben respetar los siguientes derechos de uso:

El publicador y propietario de los derechos de este trabajo es SCAR - Microbial Antarctic Resource System. Esta obra está bajo una licencia Creative Commons de Atribución/Reconocimiento (CC-BY 4.0).

Registro GBIF

Este recurso ha sido registrado en GBIF con el siguiente UUID: fcef9fcc-f737-46a1-b44e-edde5c5789a2.  SCAR - Microbial Antarctic Resource System publica este recurso y está registrado en GBIF como un publicador de datos avalado por Scientific Committee on Antarctic Research.

Palabras clave

Metadata

Contactos

Bjorn Tytgat
  • Proveedor De Contenido
  • Originador
  • Punto De Contacto
Post doctoral assistent
Ghent University
Krijgslaan 281
9000 Ghent
BE
Wim Vyverman
  • Proveedor De Contenido
  • Originador
Professor
Ghent University
Krijgslaan 281
9000 Ghent
BE
Anne Willems
  • Originador
  • Investigador Principal
Professor
Ghent University
9000 Ghent
BE
Elie Verleyen
  • Proveedor De Contenido
  • Originador
Professor
Ghent University
Krijgslaan 281
9000 Ghent
BE
Maxime Sweetlove
  • Proveedor De Los Metadatos
assistent researcher
Royal Belgian Institute for Natural Sciences
Rue Vautier 29
1000 Brussels
BE
Karolien Peeters
  • Proveedor De Contenido
Post doctoral researcher
Ghent University
BE
Zorigto Namsaraev
Post doctoral researcher
Kurchatov Institute

Cobertura geográfica

Sor Ronda Mountains, East Antarctica

Coordenadas límite Latitud Mínima Longitud Mínima [-72,1, 22,7], Latitud Máxima Longitud Máxima [-71,8, 24,6]

Cobertura taxonómica

16S ssh rRNA gene of Bacteria, using the primers pA (AGAGTTTGATCCTGGCTCAG, positions 8–27) and BKL1 (GTATTACCGCGGCTGCTGGCA, positions 536–516)

Dominio Bacteria (bacteria)

Cobertura temporal

Fecha Inicial / Fecha Final 2009-01-01 / 2010-01-01

Datos del proyecto

No hay descripción disponible

Título BELDIVA-AMBIO
Fuentes de Financiación This research was funded by the Special Research Fund BOF of (grant ) and by the Belgian Science Policy Office (BelSPO) projects BELDIVA (EA/00/05), AMBIO (SD/BA/01A) and CCAMBIO (SD/BA/03A). A. Wilmotte is Research Associate of the FRS-FNRS. This study is a contribution to the State of the Antarctic Ecosystem (AntEco) research program of the Scientific Committee on Antarctic Research (SCAR).
Descripción del área de estudio The Sop Ronda Mountains (SRM) (22° E-28° E, 71°30′ S-72°40′ S) are a 220 km long, east-west oriented mountain range, situated about 200 km inland, with peaks reaching 3300 m a.s.l. The bedrock is mainly metamorphic (e.g. gneiss) with some plutonic (granite) outcrops.

Personas asociadas al proyecto:

Bjorn Tytgat

Referencias bibliográficas

  1. Tytgat, B., Verleyen, E., Sweetlove, M., D'hondt, S., Clercx, P., Van Ranst, E., ... & Vyverman, W. (2016). Bacterial community composition in relation to bedrock type and macrobiota in soils from the Sør Rondane Mountains, East Antarctica. FEMS microbiology ecology, 92(9).

Metadatos adicionales