Description
Illumina sequencing data of bacterial communities in 52 soil samples from the western Sør Rondane Mountains (Dronning Maud Land, East Antarctica).The samples were taken along broad environmental gradients, including different types of bedrock, in an area covering nearly 1000 km2.
Versions
Le tableau ci-dessous n'affiche que les versions publiées de la ressource accessibles publiquement.
Comment citer
Veuillez noter qu'il s'agit d'une ancienne version du jeu de données. Les chercheurs doivent citer cette ressource comme suit:
Tytgat B, Vyverman W, Willems A, Verleyen E (2018): Bacteria (16S) in Antarctic terrestrial soils of the Sor Rondane Mountains. v1.3. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. http://ipt.biodiversity.aq/resource?r=bacteria_antarctic_terrestrial_soils&v=1.3
Droits
Les chercheurs doivent respecter la déclaration de droits suivante:
L’éditeur et détenteur des droits de cette ressource est SCAR - Microbial Antarctic Resource System. Ce travail est sous licence Creative Commons Attribution (CC-BY) 4.0.
Enregistrement GBIF
Cette ressource a été enregistrée sur le portail GBIF, et possède l'UUID GBIF suivante : fcef9fcc-f737-46a1-b44e-edde5c5789a2. SCAR - Microbial Antarctic Resource System publie cette ressource, et est enregistré dans le GBIF comme éditeur de données avec l'approbation du Scientific Committee on Antarctic Research.
Mots-clé
Metadata
Contacts
- Fournisseur De Contenu ●
- Créateur ●
- Personne De Contact
- Fournisseur De Contenu ●
- Créateur
- Fournisseur De Contenu ●
- Créateur
- Fournisseur Des Métadonnées
- Fournisseur De Contenu
Couverture géographique
Sor Ronda Mountains, East Antarctica
Enveloppe géographique | Sud Ouest [-72,1, 22,7], Nord Est [-71,8, 24,6] |
---|
Couverture taxonomique
16S ssh rRNA gene of Bacteria, using the primers pA (AGAGTTTGATCCTGGCTCAG, positions 8–27) and BKL1 (GTATTACCGCGGCTGCTGGCA, positions 536–516)
Domain | Bacteria (bacteria) |
---|
Couverture temporelle
Date de début / Date de fin | 2009-01-01 / 2010-01-01 |
---|
Données sur le projet
Pas de description disponible
Titre | BELDIVA-AMBIO |
---|---|
Financement | This research was funded by the Special Research Fund BOF of (grant ) and by the Belgian Science Policy Office (BelSPO) projects BELDIVA (EA/00/05), AMBIO (SD/BA/01A) and CCAMBIO (SD/BA/03A). A. Wilmotte is Research Associate of the FRS-FNRS. This study is a contribution to the State of the Antarctic Ecosystem (AntEco) research program of the Scientific Committee on Antarctic Research (SCAR). |
Description du domaine d'étude / de recherche | The Sop Ronda Mountains (SRM) (22° E-28° E, 71°30′ S-72°40′ S) are a 220 km long, east-west oriented mountain range, situated about 200 km inland, with peaks reaching 3300 m a.s.l. The bedrock is mainly metamorphic (e.g. gneiss) with some plutonic (granite) outcrops. |
Les personnes impliquées dans le projet:
Citations bibliographiques
- Tytgat, B., Verleyen, E., Sweetlove, M., D'hondt, S., Clercx, P., Van Ranst, E., ... & Vyverman, W. (2016). Bacterial community composition in relation to bedrock type and macrobiota in soils from the Sør Rondane Mountains, East Antarctica. FEMS microbiology ecology, 92(9).
Métadonnées additionnelles
Identifiants alternatifs | http://ipt.biodiversity.aq/resource?r=bacteria_antarctic_terrestrial_soils |
---|