Bacterial Diversity Assessment in Antarctic Terrestrial and Aquatic Microbial Mats

Versions

Le tableau ci-dessous n'affiche que les versions publiées de la ressource accessibles publiquement.

Comment citer

Les chercheurs doivent citer cette ressource comme suit:

Tytgat B, Vrleyen E, Obbels D, Peeters K, De Wever A, D'hondt S, De Meyer T, van Criekinge W, Vyverman W, Willems A (2018): Bacterial Diversity Assessment in Antarctic Terrestrial and Aquatic Microbial Mats. v1.1. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=bacterial_diversity_antarctica_microbial_mats&v=1.1

Droits

Les chercheurs doivent respecter la déclaration de droits suivante:

L’éditeur et détenteur des droits de cette ressource est SCAR - Microbial Antarctic Resource System. Ce travail est sous licence Creative Commons Attribution (CC-BY) 4.0.

Enregistrement GBIF

Cette ressource a été enregistrée sur le portail GBIF, et possède l'UUID GBIF suivante : f3a8b1d6-a1d1-4292-8a7e-19c63a0825bd.  SCAR - Microbial Antarctic Resource System publie cette ressource, et est enregistré dans le GBIF comme éditeur de données avec l'approbation du Scientific Committee on Antarctic Research.

Mots-clé

lake; soil; bacteria; antarctica; 16S

Contacts

Couverture géographique

soil samples and lake samples from East Antarctica

Couverture taxonomique

Bacterial 16S amplicons (V1-V3 region)

Couverture temporelle

Données sur le projet

CCAMBIO (Climate Change and Antarctic Microbial Biodiversity) is an academic project funded by the Belgian Federal Science Policy (BELSPO). Its main objective is to study the diversity, biogeographic zoning and genomic make-up of lacustrine microbial mat communities in the Antarctic Realm. CCAMBIO is composed by researchers from four Belgian Universities and Institutes (University of Liège, Ghent University, National Botanical Garden of Belgium and Royal Belgian Institute of Natural Sciences), as well as collaborators from the British Antarctic Survey.

Les personnes impliquées dans le projet:

Méthodes d'échantillonnage

Two terrestrial and seven limnetic microbial mat samples were collected aseptically during different field campaigns in December/January 2003 (PQ1, TM2 and TM4) and in January 2007 (BB50, BB115, LA3, SK5, WO10 and SO6). All samples were kept frozen during transport and stored at 220uC.

Description des étapes de la méthode:

1. DNA was extracted from frozen samples using 5 g per sample. Extracellular DNA was first removed as described by Corinaldesi et al. and DNA extraction was subsequently performed according to Zwart et al. Sequencing of the 16S rRNA V1–V3 regions was performed using forward primer pA (AGAGTTTGATCCTGGCTCAG 8–27) and reverse primer BKL1 (GTATTACCGCGGCTGCTGGCA 536– 516). Because it proved impossible to concatenate the comple- mentary reads due to insufficient overlap, the forward and reverse sequences were analyzed separately. The forward reads hence cover the complete V1 and V2 regions, whereas the reverse reads cover the V3 and part of the V2 region for the longest sequences.
2. Multiplexing was done with barcodes proposed by Parames- waran et al. Each PCR mixture contained 1–2 ml of template DNA, 2 ml of fusion primers and barcodes (10 mM), 2.5 ml dNTPs (10 mM), 1.5 ml of 10x buffer, 0.25 ml of 5 U/ml FastStart High Fidelity Polymerase (Roche) and was adjusted to a final volume of 25 ml with sterile HPLC-water. PCR cycling included 3 min at 94uC, followed by 35 cycles of 94uC for 30 s, 55uC for 60 s and 72uC for 90 s and finally 8 min at 72uC. PCR products were purified using a High Pure PCR Product Purification Kit (Roche).
3. Pyrosequencing was performed on a Roche 454 GS FLX Titanium machine at NXTGNT (Ghent, Belgium) after quality control of the DNA with a Qubit 2.0 Fluorometer (Life Technologies) and a Bioanalyzer (Agilent Technologies).

Citations bibliographiques

1. Tytgat, B., Verleyen, E., Obbels, D., Peeters, K., De Wever, A., D’hondt, S., ... & Willems, A. (2014). Bacterial diversity assessment in Antarctic terrestrial and aquatic microbial mats: a comparison between bidirectional pyrosequencing and cultivation. PloS one, 9(6), e97564.

Métadonnées additionnelles