metadata

Bacterial Diversity Assessment in Antarctic Terrestrial and Aquatic Microbial Mats

Последняя версия опубликована SCAR - Microbial Antarctic Resource System 19 марта 2019 г. SCAR - Microbial Antarctic Resource System
Bacterial data (16S rRNA) from terrestrial and aquatic Microbial mats in continental Antarctic.
Дата публикации:
19 марта 2019 г.
Техническое обеспечение:
SCAR - Microbial Antarctic Resource System
Лицензия:
CC-BY 4.0

Загрузки

Скачайте последнюю версию метаданных ресурса (только метаданные) в формате EML или RTF:

Метаданные в формате EML Скачать в English (15 kB)
Метаданные в формате RTF Скачать в English (13 kB)

Версии

В таблице ниже указаны только опубликованные версии ресурса, которые доступны для свободного скачивания.

Как оформить ссылку

Исследователи должны дать ссылку на эту работу следующим образом:

Tytgat B, Vrleyen E, Obbels D, Peeters K, De Wever A, D'hondt S, De Meyer T, van Criekinge W, Vyverman W, Willems A (2018): Bacterial Diversity Assessment in Antarctic Terrestrial and Aquatic Microbial Mats. v1.1. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=bacterial_diversity_antarctica_microbial_mats&v=1.1

Права

Исследователи должны соблюдать следующие права:

Публикующей организацией и владельцем прав на данную работу является SCAR - Microbial Antarctic Resource System. This work is licensed under a Creative Commons Attribution (CC-BY) 4.0 License.

Регистрация в GBIF

Этот ресурс был зарегистрирован в GBIF, ему был присвоен следующий UUID: f3a8b1d6-a1d1-4292-8a7e-19c63a0825bd.  SCAR - Microbial Antarctic Resource System отвечает за публикацию этого ресурса, и зарегистрирован в GBIF как издатель данных при оподдержке Scientific Committee on Antarctic Research.

Ключевые слова

lake; soil; bacteria; antarctica; 16S

Контакты

Кто является создателем ресурса:

Bjorn Tytgat
Post doctoral assistent
Ghent University
Krijgslaan 281
9000 Gent
BE
Elie Vrleyen
Professor
Ghent University
Krijgslaan 281
9000 Gent
BE
Dagmar Obbels
PhD student
Ghent University
Krijgslaan 281
9000 Gent
BE
Karolien Peeters
Post doctoral researcher
Ghent University
Krijgslaan 281
9000 Gent
BE
Aake De Wever
Post doctoral assistent
Royal Belgian Institute for Natural Sciences
Krijgslaan 281
1000 Brussels
BE
Sofie D'hondt
Lab technician
Ghent University
Tim De Meyer
Professor
Ghent University
Wim van Criekinge
Post doctoral researcher
GhentUniversity
Wim Vyverman
Professor
Ghent University
Anne Willems
Professor
Ghent Univeristy

Кто может ответить на вопросы о ресурсе:

Bjorn Tytgat
Post doctoral assistent
Ghent University
Krijgslaan 281
9000 Gent
BE

Кем заполнены метаданные:

Maxime Sweetlove
Royal Belgian Institute for Natural Sciences
Rue Vautier 29
1000 Brussels
BE

Кто еще связан с данным ресурсом:

Content Provider
Bjorn Tytgat
Post doctoral assistent
Ghent University
Krijgslaan 281
9000 Gent
BE
Content Provider
Karolien Peeters
Post doctoral researcher
Ghent University
9000 Gent
BE
Content Provider
Anne Willems
Professor
Ghent University
9000 Gent
BE

Географический охват

soil samples and lake samples from East Antarctica

Ограничивающие координаты Юг Запад [-80,45, -67,45], Север Восток [-67,7, 39,8]

Таксономический охват

Bacterial 16S amplicons (V1-V3 region)

Domain  Bacteria (Bacteria)

Временной охват

Дата начала / Дата окончания 2003-01-01 / 2007-01-01

Данные проекта

CCAMBIO (Climate Change and Antarctic Microbial Biodiversity) is an academic project funded by the Belgian Federal Science Policy (BELSPO). Its main objective is to study the diversity, biogeographic zoning and genomic make-up of lacustrine microbial mat communities in the Antarctic Realm. CCAMBIO is composed by researchers from four Belgian Universities and Institutes (University of Liège, Ghent University, National Botanical Garden of Belgium and Royal Belgian Institute of Natural Sciences), as well as collaborators from the British Antarctic Survey.

Название CCAMBIO
Идентификатор CCAMBIO
Финансирование Belgian Science Policy Office (BelSPO) project SD/BA/03

Исполнители проекта:

Bjorn Tytgat
Elie Verleyen
Dagmar Obbels
Anne Willems
Wim Vyverman

Методы сбора

Two terrestrial and seven limnetic microbial mat samples were collected aseptically during different field campaigns in December/January 2003 (PQ1, TM2 and TM4) and in January 2007 (BB50, BB115, LA3, SK5, WO10 and SO6). All samples were kept frozen during transport and stored at 220uC.

Охват исследования One sample (PQ1) was collected on Pourquoi-Pas Island off the west coast of Graham Land (Antarctic Peninsula). All other samples were collected from Eastern Antarctic habitats. The two terrestrial microbial mat samples (BB50 and BB115) were taken near the Utsteinen nunatak in the Sør Rondane Mountains (Dronning Maud Land). Three samples were from Lu ̈tzow-Holm Bay (Dronning Maud Land), namely from a small saline lake in Langhovde (LA3), from Naka-Tempyo Lake (SK5) in Skarvsnes, and from a small saline pond (WO10) in West Ongul Island. One sample (SO6) was taken from Lake Melkoye (unofficial name) in Schirmacher Oasis (Dronning Maud Land). The two remaining samples were collected in the Transantarctic Mountains. Sample TM2 was taken from Forlidas Pond (Dufek Massif, Pensacola Mountains), while sample TM4 was taken from Lundstro ̈m Lake (Shackleton Range).

Описание этапа методики:

  1. DNA was extracted from frozen samples using 5 g per sample. Extracellular DNA was first removed as described by Corinaldesi et al. and DNA extraction was subsequently performed according to Zwart et al. Sequencing of the 16S rRNA V1–V3 regions was performed using forward primer pA (AGAGTTTGATCCTGGCTCAG 8–27) and reverse primer BKL1 (GTATTACCGCGGCTGCTGGCA 536– 516). Because it proved impossible to concatenate the comple- mentary reads due to insufficient overlap, the forward and reverse sequences were analyzed separately. The forward reads hence cover the complete V1 and V2 regions, whereas the reverse reads cover the V3 and part of the V2 region for the longest sequences.
  2. Multiplexing was done with barcodes proposed by Parames- waran et al. Each PCR mixture contained 1–2 ml of template DNA, 2 ml of fusion primers and barcodes (10 mM), 2.5 ml dNTPs (10 mM), 1.5 ml of 10x buffer, 0.25 ml of 5 U/ml FastStart High Fidelity Polymerase (Roche) and was adjusted to a final volume of 25 ml with sterile HPLC-water. PCR cycling included 3 min at 94uC, followed by 35 cycles of 94uC for 30 s, 55uC for 60 s and 72uC for 90 s and finally 8 min at 72uC. PCR products were purified using a High Pure PCR Product Purification Kit (Roche).
  3. Pyrosequencing was performed on a Roche 454 GS FLX Titanium machine at NXTGNT (Ghent, Belgium) after quality control of the DNA with a Qubit 2.0 Fluorometer (Life Technologies) and a Bioanalyzer (Agilent Technologies).

Библиографические ссылки

  1. Tytgat, B., Verleyen, E., Obbels, D., Peeters, K., De Wever, A., D’hondt, S., ... & Willems, A. (2014). Bacterial diversity assessment in Antarctic terrestrial and aquatic microbial mats: a comparison between bidirectional pyrosequencing and cultivation. PloS one, 9(6), e97564.

Дополнительные метаданные

Альтернативные идентификаторы f3a8b1d6-a1d1-4292-8a7e-19c63a0825bd
https://ipt.biodiversity.aq/resource?r=bacterial_diversity_antarctica_microbial_mats