Bacterial Diversity Assessment in Antarctic Terrestrial and Aquatic Microbial Mats

Версии

В таблице ниже указаны только опубликованные версии ресурса, которые доступны для свободного скачивания.

Как оформить ссылку

Исследователи должны дать ссылку на эту работу следующим образом:

Tytgat B, Vrleyen E, Obbels D, Peeters K, De Wever A, D'hondt S, De Meyer T, van Criekinge W, Vyverman W, Willems A (2018): Bacterial Diversity Assessment in Antarctic Terrestrial and Aquatic Microbial Mats. v1.1. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=bacterial_diversity_antarctica_microbial_mats&v=1.1

Права

Исследователи должны соблюдать следующие права:

Публикующей организацией и владельцем прав на данную работу является SCAR - Microbial Antarctic Resource System. Эта работа находится под лицензией Creative Commons Attribution (CC-BY 4.0).

Регистрация в GBIF

Этот ресурс был зарегистрирован в GBIF, ему был присвоен следующий UUID: f3a8b1d6-a1d1-4292-8a7e-19c63a0825bd.  SCAR - Microbial Antarctic Resource System отвечает за публикацию этого ресурса, и зарегистрирован в GBIF как издатель данных при оподдержке Scientific Committee on Antarctic Research.

Ключевые слова

lake; soil; bacteria; antarctica; 16S

Контакты

Географический охват

soil samples and lake samples from East Antarctica

Таксономический охват

Bacterial 16S amplicons (V1-V3 region)

Временной охват

Данные проекта

CCAMBIO (Climate Change and Antarctic Microbial Biodiversity) is an academic project funded by the Belgian Federal Science Policy (BELSPO). Its main objective is to study the diversity, biogeographic zoning and genomic make-up of lacustrine microbial mat communities in the Antarctic Realm. CCAMBIO is composed by researchers from four Belgian Universities and Institutes (University of Liège, Ghent University, National Botanical Garden of Belgium and Royal Belgian Institute of Natural Sciences), as well as collaborators from the British Antarctic Survey.

Исполнители проекта:

Методы сбора

Two terrestrial and seven limnetic microbial mat samples were collected aseptically during different field campaigns in December/January 2003 (PQ1, TM2 and TM4) and in January 2007 (BB50, BB115, LA3, SK5, WO10 and SO6). All samples were kept frozen during transport and stored at 220uC.

Описание этапа методики:

1. DNA was extracted from frozen samples using 5 g per sample. Extracellular DNA was first removed as described by Corinaldesi et al. and DNA extraction was subsequently performed according to Zwart et al. Sequencing of the 16S rRNA V1–V3 regions was performed using forward primer pA (AGAGTTTGATCCTGGCTCAG 8–27) and reverse primer BKL1 (GTATTACCGCGGCTGCTGGCA 536– 516). Because it proved impossible to concatenate the comple- mentary reads due to insufficient overlap, the forward and reverse sequences were analyzed separately. The forward reads hence cover the complete V1 and V2 regions, whereas the reverse reads cover the V3 and part of the V2 region for the longest sequences.
2. Multiplexing was done with barcodes proposed by Parames- waran et al. Each PCR mixture contained 1–2 ml of template DNA, 2 ml of fusion primers and barcodes (10 mM), 2.5 ml dNTPs (10 mM), 1.5 ml of 10x buffer, 0.25 ml of 5 U/ml FastStart High Fidelity Polymerase (Roche) and was adjusted to a final volume of 25 ml with sterile HPLC-water. PCR cycling included 3 min at 94uC, followed by 35 cycles of 94uC for 30 s, 55uC for 60 s and 72uC for 90 s and finally 8 min at 72uC. PCR products were purified using a High Pure PCR Product Purification Kit (Roche).
3. Pyrosequencing was performed on a Roche 454 GS FLX Titanium machine at NXTGNT (Ghent, Belgium) after quality control of the DNA with a Qubit 2.0 Fluorometer (Life Technologies) and a Bioanalyzer (Agilent Technologies).

Библиографические ссылки

1. Tytgat, B., Verleyen, E., Obbels, D., Peeters, K., De Wever, A., D’hondt, S., ... & Willems, A. (2014). Bacterial diversity assessment in Antarctic terrestrial and aquatic microbial mats: a comparison between bidirectional pyrosequencing and cultivation. PloS one, 9(6), e97564.

Дополнительные метаданные