Microbial population dynamics along a terrestrial Antarctic moisture gradient

Versão mais recente published by SCAR - Microbial Antarctic Resource System on mar 19, 2019 SCAR - Microbial Antarctic Resource System
Publication date:
19 de março de 2019
Licença:
CC-BY 4.0

Baixe a versão mais recente dos metadados como EML ou RTF:

Metadados como um arquivo EML download em English (11 KB)
Metadados como um arquivo RTF download em English (10 KB)

Descrição

Amplicon sequencing dataset (Illumina MiSeq) of Bacteria (16S ssu rRNA gene) in soil samples from the McMurdo Dry Valleys (Antarctica) taken along a moisture gradient.

Versões

A tabela abaixo mostra apenas versões de recursos que são publicamente acessíveis.

Como citar

Pesquisadores deveriam citar esta obra da seguinte maneira:

Lee K, Caruso T, Archer S, Gillman L, Lau M, Cary C, lee C, Pointing S (2019): Microbial population dynamics along a terrestrial Antarctic moisture gradient. v1.2. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=microbes_terrestrial_antarctic_moisture_gradient&v=1.2

Direitos

Pesquisadores devem respeitar a seguinte declaração de direitos:

O editor e o detentor dos direitos deste trabalho é SCAR - Microbial Antarctic Resource System. This work is licensed under a Creative Commons Attribution (CC-BY 4.0) License.

GBIF Registration

Este recurso foi registrado no GBIF e atribuído ao seguinte GBIF UUID: f1516a8a-2f31-4215-b6df-7cdb37c98655.  SCAR - Microbial Antarctic Resource System publica este recurso, e está registrado no GBIF como um publicador de dados aprovado por Scientific Committee on Antarctic Research.

Palavras-chave

Metadata

Contatos

Kevin Lee
  • Originador
  • Ponto De Contato
Auckland University of Technology
Auckland
NZ
Tancredi Caruso
  • Originador
Queen’s University Belfast
Belfast
GB
Stephen Archer
  • Originador
Auckland University of Technology
Auckland
NZ
Len Gillman
  • Originador
Auckland University of Technology
Auckland
NZ
Maggie Lau
  • Originador
Princeton University
Princeton
US
Craig Cary
  • Originador
University of Waikato
Hamilton
NZ
Charles lee
  • Originador
University of Waikato
Hamilton
US
Stephen Pointing
  • Originador
National University of Singapore
Singapore
SG
Maxime Sweetlove
  • Provedor Dos Metadados
  • Research assistent
Royal Belgian Institute of Natural Sciences
  • Rue Vautier 29
1000 Brussels

Cobertura Geográfica

McMurdo Dry Valleys, Victoria lands, Antarctica

Coordenadas delimitadoras Sul Oeste [-77,66, 163,105], Norte Leste [-77,658, 163,127]

Cobertura Taxonômica

Bacteria, based on amplicon sequencing of the 16S ssu rRNA marker gene (v3-v4region)

Domínio Bacteria (Bacteria)

Cobertura Temporal

Data Inicial 2015-01-01

Dados Sobre o Projeto

Nenhuma descrição disponível

Título Microbial population dynamics along a terrestrial Antarctic moisture gradient
Financiamento The research was funded by a grant from the New Zealand Ministry of Business, Innovation & Employment (UOWX1401) and Yale-NUS College Start-Up Fund.

O pessoal envolvido no projeto:

Kevin Lee

Métodos de Amostragem

We adopted a zonal sampling approach where soils were retrieved that matched visible delineations along linear transects extending across the hyporheic zone from the water’s edge at each sampling station: Zone (1) Saturated soil adjacent to water’s edge; Zone (2) Wet soil as indicated by dark coloration; Zone (3) Ephemerally wet soil, dry but with evidence for previous water indicated by surface evaporites; Zone (4) Dry soil with no indication of recent moisture. Soils from each zone in each transect were recovered using aseptic technique and saturated with Lifeguard solution (Qiagen, Netherlands) (n = 16) with parallel sampling for geochemical and moisture analysis (n = 16). All samples were stored in darkness frozen at -20oC until processed.

Área de Estudo Sampling was conducted around the hyporheic zone of Spaulding Pond, Taylor Valley in the McMurdo Dry Valleys of Antarctica, during the austral summer of 2015. Four transects were defined in north-east (S77◦ 39.489′ , E163◦ 07.501′ ), south-east (S77◦ 39.513′ , E◦ 163 07.626′ ), south (S77◦ 39.589′ , E◦ 163 07.006′ ), and north-west (S77◦ 39.470′, E◦163 06.336′) facing hyporheic moisture gradients.

Descrição dos passos do método:

  1. Samples were thawed on ice and three 0.5 g extractions were conducted using the CTAB method optimized for Antarctic oligotrophic environmental samples (Archer et al., 2015). DNA yield was measured in ng/g soil. Illumina MiSeq libraries were prepared as per manufacturer’s protocol (Metagenomic Sequencing Library Preparation Part # 15044223 Rev. B; Illumina, San Diego, CA, United States) as previously described (Lee et al., 2016). PCR targeting the V3–V4 regions of bacterial and archaeal 16S rRNA gene with the primer set: PCR1 forward (5′ TCGTCGGCAGCGTCAGATGT GTATAAGAGA CAGCCTACGG GNGGCWGCAG 3′ ) and PCR1 reverse (5′ GTCTCGTGGG CTCGGAGATG TGTATAAGAG ACAGGACTAC HVGGGTATCT AATCC 3′) was conducted using KAPA HiFi Hotstart Readymix (Kapa Biosystems, Wilmington, MA, United States) and the following thermocycles: (1) 95◦C for 3 min, (2) 25 cycles of 95◦C for 30 s, 55◦C for 30 s, ◦C for 30 s, 72◦C for 5 min, and (3) holding the samples at 4◦C. The amplicons were then indexed using Nextera XT index kit (Illumina). AMPure XP beads (Beckman-Coulter, Brea, CA, United States) was used to purified the amplicon. Sequencing was conducted with an Illumina MiSeq system (Illumina) with the 500 cycle V2chemistry at Auckland University of Technology, New Zealand. A 5% PhiX spike-in was used, as per manufacturer’s recommendation.

Citações bibliográficas

  1. Lee, K. C., Archer, S. D. J., Caruso, T., Gillman, L., Lau, M. C., Cary, S. C., ... & Pointing, S. B. (2018). Stochastic and deterministic effects of a moisture gradient on soil microbial communities in the McMurdo Dry Valleys of Antarctica. Frontiers in Microbiology, 9, 2619.

Metadados Adicionais

Identificadores alternativos f1516a8a-2f31-4215-b6df-7cdb37c98655
https://ipt.biodiversity.aq/resource?r=microbes_terrestrial_antarctic_moisture_gradient