Integrated Publishing Toolkit(IPT)

free and open access to biodiversity data

Microbial population dynamics along a terrestrial Antarctic moisture gradient

Latest version published by SCAR - Microbial Antarctic Resource System on Mar 19, 2019 SCAR - Microbial Antarctic Resource System

Amplicon sequencing dataset (Illumina MiSeq) of Bacteria (16S ssu rRNA gene) in soil samples from the McMurdo Dry Valleys (Antarctica) taken along a moisture gradient.


Download the latest version of the metadata-only resource metadata as EML or RTF:

Metadata as an EML file download in English (11 KB)
Metadata as an RTF file download in English (10 KB)


The table below shows only published versions of the resource that are publicly accessible.

How to cite

Researchers should cite this work as follows:

Lee K, Caruso T, Archer S, Gillman L, Lau M, Cary C, lee C, Pointing S (2019): Microbial population dynamics along a terrestrial Antarctic moisture gradient. v1.2. SCAR - Microbial Antarctic Resource System. Dataset/Metadata.


Researchers should respect the following rights statement:

The publisher and rights holder of this work is SCAR - Microbial Antarctic Resource System. This work is licensed under a Creative Commons Attribution (CC-BY) 4.0 License.

GBIF Registration

This resource has been registered with GBIF, and assigned the following GBIF UUID: f1516a8a-2f31-4215-b6df-7cdb37c98655.  SCAR - Microbial Antarctic Resource System publishes this resource, and is itself registered in GBIF as a data publisher endorsed by Scientific Committee on Antarctic Research.




Who created the resource:

Kevin Lee
Auckland University of Technology Auckland NZ
Tancredi Caruso
Queen’s University Belfast Belfast GB
Stephen Archer
Auckland University of Technology Auckland NZ
Len Gillman
Auckland University of Technology Auckland NZ
Maggie Lau
Princeton University Princeton US
Craig Cary
University of Waikato Hamilton NZ
Charles lee
University of Waikato Hamilton US
Stephen Pointing
National University of Singapore Singapore SG

Who can answer questions about the resource:

Kevin Lee
Auckland University of Technology Auckland NZ

Who filled in the metadata:

Maxime Sweetlove
Research assistent
Royal Belgian Institute of Natural Sciences Rue Vautier 29 1000 Brussels

Who else was associated with the resource:


Geographic Coverage

McMurdo Dry Valleys, Victoria lands, Antarctica

Bounding Coordinates South West [-77.66, 163.105], North East [-77.658, 163.127]

Taxonomic Coverage

Bacteria, based on amplicon sequencing of the 16S ssu rRNA marker gene (v3-v4region)

Domain  Bacteria (Bacteria)

Temporal Coverage

Start Date 2015-01-01

Project Data

No Description available

Title Microbial population dynamics along a terrestrial Antarctic moisture gradient
Funding The research was funded by a grant from the New Zealand Ministry of Business, Innovation & Employment (UOWX1401) and Yale-NUS College Start-Up Fund.

The personnel involved in the project:

Kevin Lee

Sampling Methods

We adopted a zonal sampling approach where soils were retrieved that matched visible delineations along linear transects extending across the hyporheic zone from the water’s edge at each sampling station: Zone (1) Saturated soil adjacent to water’s edge; Zone (2) Wet soil as indicated by dark coloration; Zone (3) Ephemerally wet soil, dry but with evidence for previous water indicated by surface evaporites; Zone (4) Dry soil with no indication of recent moisture. Soils from each zone in each transect were recovered using aseptic technique and saturated with Lifeguard solution (Qiagen, Netherlands) (n = 16) with parallel sampling for geochemical and moisture analysis (n = 16). All samples were stored in darkness frozen at -20oC until processed.

Study Extent Sampling was conducted around the hyporheic zone of Spaulding Pond, Taylor Valley in the McMurdo Dry Valleys of Antarctica, during the austral summer of 2015. Four transects were defined in north-east (S77◦ 39.489′ , E163◦ 07.501′ ), south-east (S77◦ 39.513′ , E◦ 163 07.626′ ), south (S77◦ 39.589′ , E◦ 163 07.006′ ), and north-west (S77◦ 39.470′, E◦163 06.336′) facing hyporheic moisture gradients.

Method step description:

  1. Samples were thawed on ice and three 0.5 g extractions were conducted using the CTAB method optimized for Antarctic oligotrophic environmental samples (Archer et al., 2015). DNA yield was measured in ng/g soil. Illumina MiSeq libraries were prepared as per manufacturer’s protocol (Metagenomic Sequencing Library Preparation Part # 15044223 Rev. B; Illumina, San Diego, CA, United States) as previously described (Lee et al., 2016). PCR targeting the V3–V4 regions of bacterial and archaeal 16S rRNA gene with the primer set: PCR1 forward (5′ TCGTCGGCAGCGTCAGATGT GTATAAGAGA CAGCCTACGG GNGGCWGCAG 3′ ) and PCR1 reverse (5′ GTCTCGTGGG CTCGGAGATG TGTATAAGAG ACAGGACTAC HVGGGTATCT AATCC 3′) was conducted using KAPA HiFi Hotstart Readymix (Kapa Biosystems, Wilmington, MA, United States) and the following thermocycles: (1) 95◦C for 3 min, (2) 25 cycles of 95◦C for 30 s, 55◦C for 30 s, ◦C for 30 s, 72◦C for 5 min, and (3) holding the samples at 4◦C. The amplicons were then indexed using Nextera XT index kit (Illumina). AMPure XP beads (Beckman-Coulter, Brea, CA, United States) was used to purified the amplicon. Sequencing was conducted with an Illumina MiSeq system (Illumina) with the 500 cycle V2chemistry at Auckland University of Technology, New Zealand. A 5% PhiX spike-in was used, as per manufacturer’s recommendation.

Bibliographic Citations

  1. Lee, K. C., Archer, S. D. J., Caruso, T., Gillman, L., Lau, M. C., Cary, S. C., ... & Pointing, S. B. (2018). Stochastic and deterministic effects of a moisture gradient on soil microbial communities in the McMurdo Dry Valleys of Antarctica. Frontiers in Microbiology, 9, 2619.

Additional Metadata

Alternative Identifiers f1516a8a-2f31-4215-b6df-7cdb37c98655