Microbial population dynamics along a terrestrial Antarctic moisture gradient

Версии

В таблице ниже указаны только опубликованные версии ресурса, которые доступны для свободного скачивания.

Как оформить ссылку

Исследователи должны дать ссылку на эту работу следующим образом:

Lee K, Caruso T, Archer S, Gillman L, Lau M, Cary C, lee C, Pointing S (2019): Microbial population dynamics along a terrestrial Antarctic moisture gradient. v1.2. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=microbes_terrestrial_antarctic_moisture_gradient&v=1.2

Права

Исследователи должны соблюдать следующие права:

Публикующей организацией и владельцем прав на данную работу является SCAR - Microbial Antarctic Resource System. Эта работа находится под лицензией Creative Commons Attribution (CC-BY 4.0).

Регистрация в GBIF

Этот ресурс был зарегистрирован в GBIF, ему был присвоен следующий UUID: f1516a8a-2f31-4215-b6df-7cdb37c98655.  SCAR - Microbial Antarctic Resource System отвечает за публикацию этого ресурса, и зарегистрирован в GBIF как издатель данных при оподдержке Scientific Committee on Antarctic Research.

Ключевые слова

Metadata

Контакты

Географический охват

McMurdo Dry Valleys, Victoria lands, Antarctica

Таксономический охват

Bacteria, based on amplicon sequencing of the 16S ssu rRNA marker gene (v3-v4region)

Временной охват

Данные проекта

Описание отсутсвует

Исполнители проекта:

Методы сбора

We adopted a zonal sampling approach where soils were retrieved that matched visible delineations along linear transects extending across the hyporheic zone from the water’s edge at each sampling station: Zone (1) Saturated soil adjacent to water’s edge; Zone (2) Wet soil as indicated by dark coloration; Zone (3) Ephemerally wet soil, dry but with evidence for previous water indicated by surface evaporites; Zone (4) Dry soil with no indication of recent moisture. Soils from each zone in each transect were recovered using aseptic technique and saturated with Lifeguard solution (Qiagen, Netherlands) (n = 16) with parallel sampling for geochemical and moisture analysis (n = 16). All samples were stored in darkness frozen at -20oC until processed.

Описание этапа методики:

1. Samples were thawed on ice and three 0.5 g extractions were conducted using the CTAB method optimized for Antarctic oligotrophic environmental samples (Archer et al., 2015). DNA yield was measured in ng/g soil. Illumina MiSeq libraries were prepared as per manufacturer’s protocol (Metagenomic Sequencing Library Preparation Part # 15044223 Rev. B; Illumina, San Diego, CA, United States) as previously described (Lee et al., 2016). PCR targeting the V3–V4 regions of bacterial and archaeal 16S rRNA gene with the primer set: PCR1 forward (5′ TCGTCGGCAGCGTCAGATGT GTATAAGAGA CAGCCTACGG GNGGCWGCAG 3′ ) and PCR1 reverse (5′ GTCTCGTGGG CTCGGAGATG TGTATAAGAG ACAGGACTAC HVGGGTATCT AATCC 3′) was conducted using KAPA HiFi Hotstart Readymix (Kapa Biosystems, Wilmington, MA, United States) and the following thermocycles: (1) 95◦C for 3 min, (2) 25 cycles of 95◦C for 30 s, 55◦C for 30 s, ◦C for 30 s, 72◦C for 5 min, and (3) holding the samples at 4◦C. The amplicons were then indexed using Nextera XT index kit (Illumina). AMPure XP beads (Beckman-Coulter, Brea, CA, United States) was used to purified the amplicon. Sequencing was conducted with an Illumina MiSeq system (Illumina) with the 500 cycle V2chemistry at Auckland University of Technology, New Zealand. A 5% PhiX spike-in was used, as per manufacturer’s recommendation.

Библиографические ссылки

1. Lee, K. C., Archer, S. D. J., Caruso, T., Gillman, L., Lau, M. C., Cary, S. C., ... & Pointing, S. B. (2018). Stochastic and deterministic effects of a moisture gradient on soil microbial communities in the McMurdo Dry Valleys of Antarctica. Frontiers in Microbiology, 9, 2619.

Дополнительные метаданные