Microbial soil Fungi (ITS2) diversity from Maritime Antarctica

Versión 1.0 publicado por SCAR - Microbial Antarctic Resource System el ene. 8, 2019 SCAR - Microbial Antarctic Resource System
Fecha de publicación:
8 de enero de 2019
Licencia:
CC-BY 4.0

Descargue la última versión de los metadatos como EML o RTF:

Metadatos como un archivo EML descargar en Inglés (10 KB)
Metadatos como un archivo RTF descargar en Inglés (10 KB)

Descripción

Amplicon sequencing dataset (454) of microbial fungi (ITS2 marker gene) in soils from the Antarctic Peninsula and Maritime Antarctic Islands.

Versiones

La siguiente tabla muestra sólo las versiones publicadas del recurso que son de acceso público.

¿Cómo referenciar?

Por favor, tenga en cuenta que ésta es una versión antigua del conjunto de datos.  Los usuarios deben citar este trabajo de la siguiente manera:

Newsham K, Hopkins D, Carvalhais L, Fretwell P, Rushton S, O'Donnell A, Dennis P (2019): Microbial soil Fungi (ITS2) diversity from Maritime Antarctica. v1.0. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. http://ipt.biodiversity.aq/resource?r=soil_fungi_its2_maritime_antarctica&v=1.0

Derechos

Los usuarios deben respetar los siguientes derechos de uso:

El publicador y propietario de los derechos de este trabajo es SCAR - Microbial Antarctic Resource System. Esta obra está bajo una licencia Creative Commons de Atribución/Reconocimiento (CC-BY 4.0).

Registro GBIF

Este recurso ha sido registrado en GBIF con el siguiente UUID: 7c5815a5-7909-418b-87dc-af0cab0e57ce.  SCAR - Microbial Antarctic Resource System publica este recurso y está registrado en GBIF como un publicador de datos avalado por Scientific Committee on Antarctic Research.

Palabras clave

Metadata

Contactos

Kevin Newsham
  • Originador
  • Punto De Contacto
  • Adjunct professor
British Antarctic Survey
Cambridge
GB
David Hopkins
  • Originador
  • Professor
The Royal Agricultural University
Cirencester
GB
Lilia Carvalhais
  • Originador
  • Research fellow
The University of Queensland
Brisbane
AU
Peter Fretwell
  • Originador
  • Geographic information officer
British Antarctic Survey
Cambridge
GB
Steven Rushton
  • Originador
  • Professor
Newcastle University
Newcastle upon Tyne
GB
Anthony O'Donnell
  • Originador
  • Professor
University of Western Australia
Crawley
AU
Paul Dennis
  • Originador
  • Punto De Contacto
  • Senior lecturer
The University of Queensland
Brisbane
AU
Maxime Sweetlove
  • Proveedor De Los Metadatos
  • Research assistent
Royal Belgian Institute for Natural Sciences
  • Rue Vautier 29
1000 Brussels
BE

Cobertura geográfica

Soil samples from the Antarctic Peninsula and Maritime Antarctic Islands.

Coordenadas límite Latitud Mínima Longitud Mínima [-71,878, -71,844], Latitud Máxima Longitud Máxima [-60,701, -45,661]

Cobertura taxonómica

microbial soil Fungi, ITS2 marker gene

Filo Fungi (Fungi)

Datos del proyecto

No hay descripción disponible

Título Microbial soil Fungi (ITS2) diversity from Maritime Antarctica
Fuentes de Financiación This work was funded by a UK Natural Environment Research Council Antarctic Funding Initiative grant (NE/D00893X/1; AFI 7/05) and a University of Queensland Early Career Researcher Award.

Personas asociadas al proyecto:

David Hopkins

Métodos de muestreo

The uppermost five centimetres of soil was collected in 50 ml DNA/RNAase-treated plastic tubes (30 mm diam.) from each of five locations at each site and was bulked. The soil was then immediately snap-frozen by immersion in a mixture of dry ice and ethanol (c. -80 °C). Samples were maintained at -80 °C from the time of sampling until they were processed.

Área de Estudio Soils without plant cover were sampled along the climatic gradient in Maritime Antarctica.

Descripción de la metodología paso a paso:

  1. Total DNA was extracted under sterile conditions from 10 g of soil using a PowerMax® Soil DNA isolation kit (MO BIO Laboratories, Inc., Carlsbad, CA, USA) as per the manufacturer’s instructions. The internal transcribed spacer 2 (ITS2) region of the ribosomal RNA encoding genes was amplified by polymerase chain reaction (PCR) using the primers gITS7 (5′ GTGARTCATCGARTCTTTG27) and ITS4 (5′ TCCTCCGCTTATTGATATGC28), which target sites in the 5.8S gene and ribosomal large subunit, respectively. The gITS7 primer was 5’-labelled with the 454 FLX sequencing primer adapter B sequence and the ITS4 primer was 5’-labelled with a sample specific barcode sequence and the 454 FLX sequencing primer adapter A sequence. PCRs were performed in duplicate 50 μl reactions, each containing 5 ng template DNA, 1X Phusion® High Fidelity PCR Buffer (New England Biolabs Inc.), 0.2 mM of each of the dNTPs (Invitrogen), 0.3 μM of the ITS4 primer, 0.5 μM of the gITS7 primer, and 1U of 1X Phusion® High Fidelity DNA Polymerase (New England Biolabs Inc.). Thermocycling conditions were as follows: 98 °C for 30 s, 35 cycles of 98 °C for 10 s, 56 °C for 30 s, 72 °C for 15 s and a final extension at 72 °C for 7 min. Negative controls, consisting of sterile water in place of template DNA, did not yield amplicons. Amplicons were purified using a Wizard® SV Gel and PCR Clean-Up System (Promega), quantified with a Qubit fluorometer with a Quant-iT dsDNA HF assay kit and then 72 ng of each sample was pooled. The pooled sample was purified again using a QIAquick PCR Purification Kit (Qiagen), and then sent to Macrogen (Seoul, Korea) for 454 pyrosequencing.

Referencias bibliográficas

  1. Newsham, K. K., Hopkins, D. W., Carvalhais, L. C., Fretwell, P. T., Rushton, S. P., O’Donnell, A. G., & Dennis, P. G. (2016). Relationship between soil fungal diversity and temperature in the maritime Antarctic. Nature Climate Change, 6(2), 182.

Metadatos adicionales