Microbial soil Fungi (ITS2) diversity from Maritime Antarctica

Versão 1.0 published by SCAR - Microbial Antarctic Resource System on jan 8, 2019 SCAR - Microbial Antarctic Resource System
Publication date:
8 de Janeiro de 2019
Licença:
CC-BY 4.0

Baixe a versão mais recente dos metadados como EML ou RTF:

Metadados como um arquivo EML download em English (10 KB)
Metadados como um arquivo RTF download em English (10 KB)

Descrição

Amplicon sequencing dataset (454) of microbial fungi (ITS2 marker gene) in soils from the Antarctic Peninsula and Maritime Antarctic Islands.

Versões

A tabela abaixo mostra apenas versões de recursos que são publicamente acessíveis.

Como citar

Lembre-se, esta é uma versão antiga do dataset.  Pesquisadores deveriam citar esta obra da seguinte maneira:

Newsham K, Hopkins D, Carvalhais L, Fretwell P, Rushton S, O'Donnell A, Dennis P (2019): Microbial soil Fungi (ITS2) diversity from Maritime Antarctica. v1.0. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. http://ipt.biodiversity.aq/resource?r=soil_fungi_its2_maritime_antarctica&v=1.0

Direitos

Pesquisadores devem respeitar a seguinte declaração de direitos:

O editor e o detentor dos direitos deste trabalho é SCAR - Microbial Antarctic Resource System. This work is licensed under a Creative Commons Attribution (CC-BY 4.0) License.

GBIF Registration

Este recurso foi registrado no GBIF e atribuído ao seguinte GBIF UUID: 7c5815a5-7909-418b-87dc-af0cab0e57ce.  SCAR - Microbial Antarctic Resource System publica este recurso, e está registrado no GBIF como um publicador de dados aprovado por Scientific Committee on Antarctic Research.

Palavras-chave

Metadata

Contatos

Kevin Newsham
  • Originador
  • Ponto De Contato
Adjunct professor
British Antarctic Survey
Cambridge
GB
David Hopkins
  • Originador
Professor
The Royal Agricultural University
Cirencester
GB
Lilia Carvalhais
  • Originador
Research fellow
The University of Queensland
Brisbane
AU
Peter Fretwell
  • Originador
Geographic information officer
British Antarctic Survey
Cambridge
GB
Steven Rushton
  • Originador
Professor
Newcastle University
Newcastle upon Tyne
GB
Anthony O'Donnell
  • Originador
Professor
University of Western Australia
Crawley
AU
Paul Dennis
  • Originador
  • Ponto De Contato
Senior lecturer
The University of Queensland
Brisbane
AU
Maxime Sweetlove
  • Provedor Dos Metadados
Research assistent
Royal Belgian Institute for Natural Sciences
Rue Vautier 29
1000 Brussels
BE

Cobertura Geográfica

Soil samples from the Antarctic Peninsula and Maritime Antarctic Islands.

Coordenadas delimitadoras Sul Oeste [-71,878, -71,844], Norte Leste [-60,701, -45,661]

Cobertura Taxonômica

microbial soil Fungi, ITS2 marker gene

Filo Fungi (Fungi)

Dados Sobre o Projeto

Nenhuma descrição disponível

Título Microbial soil Fungi (ITS2) diversity from Maritime Antarctica
Financiamento This work was funded by a UK Natural Environment Research Council Antarctic Funding Initiative grant (NE/D00893X/1; AFI 7/05) and a University of Queensland Early Career Researcher Award.

O pessoal envolvido no projeto:

David Hopkins

Métodos de Amostragem

The uppermost five centimetres of soil was collected in 50 ml DNA/RNAase-treated plastic tubes (30 mm diam.) from each of five locations at each site and was bulked. The soil was then immediately snap-frozen by immersion in a mixture of dry ice and ethanol (c. -80 °C). Samples were maintained at -80 °C from the time of sampling until they were processed.

Área de Estudo Soils without plant cover were sampled along the climatic gradient in Maritime Antarctica.

Descrição dos passos do método:

  1. Total DNA was extracted under sterile conditions from 10 g of soil using a PowerMax® Soil DNA isolation kit (MO BIO Laboratories, Inc., Carlsbad, CA, USA) as per the manufacturer’s instructions. The internal transcribed spacer 2 (ITS2) region of the ribosomal RNA encoding genes was amplified by polymerase chain reaction (PCR) using the primers gITS7 (5′ GTGARTCATCGARTCTTTG27) and ITS4 (5′ TCCTCCGCTTATTGATATGC28), which target sites in the 5.8S gene and ribosomal large subunit, respectively. The gITS7 primer was 5’-labelled with the 454 FLX sequencing primer adapter B sequence and the ITS4 primer was 5’-labelled with a sample specific barcode sequence and the 454 FLX sequencing primer adapter A sequence. PCRs were performed in duplicate 50 μl reactions, each containing 5 ng template DNA, 1X Phusion® High Fidelity PCR Buffer (New England Biolabs Inc.), 0.2 mM of each of the dNTPs (Invitrogen), 0.3 μM of the ITS4 primer, 0.5 μM of the gITS7 primer, and 1U of 1X Phusion® High Fidelity DNA Polymerase (New England Biolabs Inc.). Thermocycling conditions were as follows: 98 °C for 30 s, 35 cycles of 98 °C for 10 s, 56 °C for 30 s, 72 °C for 15 s and a final extension at 72 °C for 7 min. Negative controls, consisting of sterile water in place of template DNA, did not yield amplicons. Amplicons were purified using a Wizard® SV Gel and PCR Clean-Up System (Promega), quantified with a Qubit fluorometer with a Quant-iT dsDNA HF assay kit and then 72 ng of each sample was pooled. The pooled sample was purified again using a QIAquick PCR Purification Kit (Qiagen), and then sent to Macrogen (Seoul, Korea) for 454 pyrosequencing.

Citações bibliográficas

  1. Newsham, K. K., Hopkins, D. W., Carvalhais, L. C., Fretwell, P. T., Rushton, S. P., O’Donnell, A. G., & Dennis, P. G. (2016). Relationship between soil fungal diversity and temperature in the maritime Antarctic. Nature Climate Change, 6(2), 182.

Metadados Adicionais