Aeolian microbial dispersal limitation to Antarctica (2017)

Métadonnées uniquement
Dernière version Publié par SCAR - Microbial Antarctic Resource System le juin 16, 2021 SCAR - Microbial Antarctic Resource System
Date de publication:
16 juin 2021
Licence:
CC-BY 4.0

Téléchargez la dernière version de la ressource "Métadonnées uniquement" au format EML ou RTF :

Métadonnées sous forme de fichier EML télécharger dans Anglais (8 KB)
Métadonnées sous forme de fichier RTF télécharger dans Anglais (9 KB)

Description

Amplicon sequencing dataset (Illumina MiSeq) targeting Bacteria (16S ssu rRNA) and Fungi (ITS) in samples (n=110) from soils and aerosol in the McMurdo Dry Valleys and New Zealand.

Versions

Le tableau ci-dessous n'affiche que les versions publiées de la ressource accessibles publiquement.

Comment citer

Les chercheurs doivent citer cette ressource comme suit:

Archer S, Maestre F, Maki T, Lee C, Cowan D, Pointing S (2021): Aeolian microbial dispersal limitation to Antarctica (2017). v1.0. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=aeolian_microbes_antarctica&v=1.0

Droits

Les chercheurs doivent respecter la déclaration de droits suivante:

L’éditeur et détenteur des droits de cette ressource est SCAR - Microbial Antarctic Resource System. Ce travail est sous licence Creative Commons Attribution (CC-BY) 4.0.

Enregistrement GBIF

Cette ressource a été enregistrée sur le portail GBIF, et possède l'UUID GBIF suivante : 800104b4-cea6-41d7-8944-0fdcca7a7aa8.  SCAR - Microbial Antarctic Resource System publie cette ressource, et est enregistré dans le GBIF comme éditeur de données avec l'approbation du Scientific Committee on Antarctic Research.

Mots-clé

Metadata

Contacts

Stephen Archer
  • Créateur ●
  • Utilisateur ●
  • Personne De Contact
Institute for Applied Ecology New Zealand
Auckland
NZ
Fernando Maestre
  • Créateur
Universidad Rey Juan Carlos
Mostoles
ES
Teruya Maki
  • Créateur
Kanazawa University
Kanazawa
JP
Charles Lee
  • Créateur
University of Waikato
Hamilton
NZ
Don Cowan
  • Créateur
University of Pretoria
Pretoria
ZA
Stephen Pointing
  • Créateur
Institute for Applied Ecology New Zealand
Auckland
NZ
Maxime Sweetlove
  • Fournisseur Des Métadonnées
Royal Belgian Institute of Natural Sciences
Brussels
BE

Couverture géographique

Antarctica:McMurdo Dry Valleys:Bull Pass, Valley ridge; New Zealand:Glen Eden, Auckland

Enveloppe géographique Sud Ouest [-77,519, 161,769], Nord Est [-36,916, 174,646]

Données sur le projet

Pas de description disponible

Titre Aeolian microbial dispersal limitation to Antarctica (2017)
Financement Funding was provided by a grant from the New Zealand Ministry of Business, Innovation & Employment (UOWX1401) and the Yale-NUS College Start-Up Fund. Additional support was given by the European Research Council (BIODESERT project, ERC Grant agreement n° 647038).

Les personnes impliquées dans le projet:

Stephen Archer

Méthodes d'échantillonnage

Sampling of air mass above the boundary layer for surface influence was achieved by mounting the apparatus in a helicopter with an external sampling port.

Etendue de l'étude Air mass at near-surface (1.5m above ground) and underlying soil was sampled from 11 to 23 January 2017 at valley and elevated locations throughout the Wright Valley, McMurdo Dry Valleys, Antarctica. Comparison samples were taken from the North Island of New Zealand.

Description des étapes de la méthode:

  1. Total DNA was directly extracted using a CTAB protocol. DNA yield for these ultra-low biomass samples was quantified using the Qubit 2.0 Fluorometer (Invitrogen) in the range 1.06-8.44ng. Samples were then stored at -20 C. Illumina MiSeq libraries were prepared as per manufacturer’s protocol (Metagenomic Sequencing Library Preparation Part # 15044223 Rev. B; Illumina, San Diego, CA, USA) and with PhiX positive controls. Bacteria and Fungi were targeted with domain-specific PCR primers PCR1 forward (5’ TCGTCGGCAGCGTCAGATGT GTATAAGAGA CAGCCTACGG GNGGCWGCAG 3’) and PCR1 reverse (5’ GTCTCGTGGG CTCGGAGATG TGTATAAGAG ACAGGACTAC HVGGGTATCT AATCC 3’) and the internal transcribed spacer region of fungal 18S and 5.8S rRNA genes: ITS1 forward (5' CTTGGTCATTTAGAGGAAGTAA 3') and ITS2 reverse (5' GCTGCGTTCTTCATCGATGC 3').

Citations bibliographiques

  1. Archer, S., Lee, K., Caruso, T., Maki, T., Lee, C., Cowan, D., ... & Pointing, S. (2018). Microbial dispersal limitation to isolated soil habitats in the McMurdo Dry Valleys of Antarctica. bioRxiv, 493411. https://doi.org/10.1101/493411

Métadonnées additionnelles