Description
Amplicon sequencing dataset (Illumina MiSeq) targeting Bacteria (16S ssu rRNA) and Fungi (ITS) in samples (n=110) from soils and aerosol in the McMurdo Dry Valleys and New Zealand.
Versions
Le tableau ci-dessous n'affiche que les versions publiées de la ressource accessibles publiquement.
Comment citer
Les chercheurs doivent citer cette ressource comme suit:
Archer S, Maestre F, Maki T, Lee C, Cowan D, Pointing S (2021): Aeolian microbial dispersal limitation to Antarctica (2017). v1.0. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=aeolian_microbes_antarctica&v=1.0
Droits
Les chercheurs doivent respecter la déclaration de droits suivante:
L’éditeur et détenteur des droits de cette ressource est SCAR - Microbial Antarctic Resource System. Ce travail est sous licence Creative Commons Attribution (CC-BY) 4.0.
Enregistrement GBIF
Cette ressource a été enregistrée sur le portail GBIF, et possède l'UUID GBIF suivante : 800104b4-cea6-41d7-8944-0fdcca7a7aa8. SCAR - Microbial Antarctic Resource System publie cette ressource, et est enregistré dans le GBIF comme éditeur de données avec l'approbation du Scientific Committee on Antarctic Research.
Mots-clé
Metadata
Contacts
- Créateur ●
- Utilisateur ●
- Personne De Contact
- Créateur
- Créateur
- Créateur
- Créateur
- Créateur
- Fournisseur Des Métadonnées
Couverture géographique
Antarctica:McMurdo Dry Valleys:Bull Pass, Valley ridge; New Zealand:Glen Eden, Auckland
| Enveloppe géographique | Sud Ouest [-77,519, 161,769], Nord Est [-36,916, 174,646] |
|---|
Données sur le projet
Pas de description disponible
| Titre | Aeolian microbial dispersal limitation to Antarctica (2017) |
|---|---|
| Financement | Funding was provided by a grant from the New Zealand Ministry of Business, Innovation & Employment (UOWX1401) and the Yale-NUS College Start-Up Fund. Additional support was given by the European Research Council (BIODESERT project, ERC Grant agreement n° 647038). |
Les personnes impliquées dans le projet:
Méthodes d'échantillonnage
Sampling of air mass above the boundary layer for surface influence was achieved by mounting the apparatus in a helicopter with an external sampling port.
| Etendue de l'étude | Air mass at near-surface (1.5m above ground) and underlying soil was sampled from 11 to 23 January 2017 at valley and elevated locations throughout the Wright Valley, McMurdo Dry Valleys, Antarctica. Comparison samples were taken from the North Island of New Zealand. |
|---|
Description des étapes de la méthode:
- Total DNA was directly extracted using a CTAB protocol. DNA yield for these ultra-low biomass samples was quantified using the Qubit 2.0 Fluorometer (Invitrogen) in the range 1.06-8.44ng. Samples were then stored at -20 C. Illumina MiSeq libraries were prepared as per manufacturer’s protocol (Metagenomic Sequencing Library Preparation Part # 15044223 Rev. B; Illumina, San Diego, CA, USA) and with PhiX positive controls. Bacteria and Fungi were targeted with domain-specific PCR primers PCR1 forward (5’ TCGTCGGCAGCGTCAGATGT GTATAAGAGA CAGCCTACGG GNGGCWGCAG 3’) and PCR1 reverse (5’ GTCTCGTGGG CTCGGAGATG TGTATAAGAG ACAGGACTAC HVGGGTATCT AATCC 3’) and the internal transcribed spacer region of fungal 18S and 5.8S rRNA genes: ITS1 forward (5' CTTGGTCATTTAGAGGAAGTAA 3') and ITS2 reverse (5' GCTGCGTTCTTCATCGATGC 3').
Citations bibliographiques
- Archer, S., Lee, K., Caruso, T., Maki, T., Lee, C., Cowan, D., ... & Pointing, S. (2018). Microbial dispersal limitation to isolated soil habitats in the McMurdo Dry Valleys of Antarctica. bioRxiv, 493411. https://doi.org/10.1101/493411
Métadonnées additionnelles
| Identifiants alternatifs | https://ipt.biodiversity.aq/resource?r=aeolian_microbes_antarctica |
|---|