Aeolian microbial dispersal limitation to Antarctica (2017)

Metadata-only
Последняя версия опубликовано SCAR - Microbial Antarctic Resource System июн. 16, 2021 SCAR - Microbial Antarctic Resource System
Дата публикации:
16 июня 2021 г.
Опубликовано:
SCAR - Microbial Antarctic Resource System
Лицензия:
CC-BY 4.0

Скачайте последнюю версию метаданных ресурса (только метаданные) в формате EML или RTF:

Метаданные в формате EML Скачать в English (8 KB)
Метаданные в формате RTF Скачать в English (9 KB)

Описание

Amplicon sequencing dataset (Illumina MiSeq) targeting Bacteria (16S ssu rRNA) and Fungi (ITS) in samples (n=110) from soils and aerosol in the McMurdo Dry Valleys and New Zealand.

Версии

В таблице ниже указаны только опубликованные версии ресурса, которые доступны для свободного скачивания.

Как оформить ссылку

Исследователи должны дать ссылку на эту работу следующим образом:

Archer S, Maestre F, Maki T, Lee C, Cowan D, Pointing S (2021): Aeolian microbial dispersal limitation to Antarctica (2017). v1.0. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=aeolian_microbes_antarctica&v=1.0

Права

Исследователи должны соблюдать следующие права:

Публикующей организацией и владельцем прав на данную работу является SCAR - Microbial Antarctic Resource System. Эта работа находится под лицензией Creative Commons Attribution (CC-BY 4.0).

Регистрация в GBIF

Этот ресурс был зарегистрирован в GBIF, ему был присвоен следующий UUID: 800104b4-cea6-41d7-8944-0fdcca7a7aa8.  SCAR - Microbial Antarctic Resource System отвечает за публикацию этого ресурса, и зарегистрирован в GBIF как издатель данных при оподдержке Scientific Committee on Antarctic Research.

Ключевые слова

Metadata

Контакты

Stephen Archer
  • Originator ●
  • User ●
  • Point Of Contact
Institute for Applied Ecology New Zealand
Auckland
NZ
Fernando Maestre
  • Originator
Universidad Rey Juan Carlos
Mostoles
ES
Teruya Maki
  • Originator
Kanazawa University
Kanazawa
JP
Charles Lee
  • Originator
University of Waikato
Hamilton
NZ
Don Cowan
  • Originator
University of Pretoria
Pretoria
ZA
Stephen Pointing
  • Originator
Institute for Applied Ecology New Zealand
Auckland
NZ
Maxime Sweetlove
  • Metadata Provider
Royal Belgian Institute of Natural Sciences
Brussels
BE

Географический охват

Antarctica:McMurdo Dry Valleys:Bull Pass, Valley ridge; New Zealand:Glen Eden, Auckland

Ограничивающие координаты Юг Запад [-77,519, 161,769], Север Восток [-36,916, 174,646]

Данные проекта

Описание отсутсвует

Название Aeolian microbial dispersal limitation to Antarctica (2017)
Финансирование Funding was provided by a grant from the New Zealand Ministry of Business, Innovation & Employment (UOWX1401) and the Yale-NUS College Start-Up Fund. Additional support was given by the European Research Council (BIODESERT project, ERC Grant agreement n° 647038).

Исполнители проекта:

Stephen Archer

Методы сбора

Sampling of air mass above the boundary layer for surface influence was achieved by mounting the apparatus in a helicopter with an external sampling port.

Охват исследования Air mass at near-surface (1.5m above ground) and underlying soil was sampled from 11 to 23 January 2017 at valley and elevated locations throughout the Wright Valley, McMurdo Dry Valleys, Antarctica. Comparison samples were taken from the North Island of New Zealand.

Описание этапа методики:

  1. Total DNA was directly extracted using a CTAB protocol. DNA yield for these ultra-low biomass samples was quantified using the Qubit 2.0 Fluorometer (Invitrogen) in the range 1.06-8.44ng. Samples were then stored at -20 C. Illumina MiSeq libraries were prepared as per manufacturer’s protocol (Metagenomic Sequencing Library Preparation Part # 15044223 Rev. B; Illumina, San Diego, CA, USA) and with PhiX positive controls. Bacteria and Fungi were targeted with domain-specific PCR primers PCR1 forward (5’ TCGTCGGCAGCGTCAGATGT GTATAAGAGA CAGCCTACGG GNGGCWGCAG 3’) and PCR1 reverse (5’ GTCTCGTGGG CTCGGAGATG TGTATAAGAG ACAGGACTAC HVGGGTATCT AATCC 3’) and the internal transcribed spacer region of fungal 18S and 5.8S rRNA genes: ITS1 forward (5' CTTGGTCATTTAGAGGAAGTAA 3') and ITS2 reverse (5' GCTGCGTTCTTCATCGATGC 3').

Библиографические ссылки

  1. Archer, S., Lee, K., Caruso, T., Maki, T., Lee, C., Cowan, D., ... & Pointing, S. (2018). Microbial dispersal limitation to isolated soil habitats in the McMurdo Dry Valleys of Antarctica. bioRxiv, 493411. https://doi.org/10.1101/493411

Дополнительные метаданные

Альтернативные идентификаторы https://ipt.biodiversity.aq/resource?r=aeolian_microbes_antarctica